Incidental Mutation 'R8671:Nynrin'
ID 661176
Institutional Source Beutler Lab
Gene Symbol Nynrin
Ensembl Gene ENSMUSG00000075592
Gene Name NYN domain and retroviral integrase containing
Synonyms
MMRRC Submission 068526-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8671 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 56091572-56112193 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 56107899 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 1002 (V1002E)
Ref Sequence ENSEMBL: ENSMUSP00000098098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100529] [ENSMUST00000168479]
AlphaFold Q5DTZ0
Predicted Effect possibly damaging
Transcript: ENSMUST00000100529
AA Change: V1002E

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000098098
Gene: ENSMUSG00000075592
AA Change: V1002E

DomainStartEndE-ValueType
low complexity region 581 606 N/A INTRINSIC
Pfam:RNase_Zc3h12a 739 890 1.6e-54 PFAM
low complexity region 938 952 N/A INTRINSIC
low complexity region 1212 1228 N/A INTRINSIC
low complexity region 1390 1397 N/A INTRINSIC
PDB:3S3O|B 1478 1706 6e-8 PDB
SCOP:d1cxqa_ 1552 1646 2e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168479
AA Change: V1002E

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129557
Gene: ENSMUSG00000075592
AA Change: V1002E

DomainStartEndE-ValueType
low complexity region 581 606 N/A INTRINSIC
Pfam:RNase_Zc3h12a 739 890 5.5e-54 PFAM
low complexity region 938 952 N/A INTRINSIC
low complexity region 1212 1228 N/A INTRINSIC
low complexity region 1390 1397 N/A INTRINSIC
PDB:3S3O|B 1478 1706 6e-8 PDB
SCOP:d1cxqa_ 1552 1646 2e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik C T 4: 73,861,166 (GRCm39) E145K probably damaging Het
Ambp A T 4: 63,068,656 (GRCm39) Y120* probably null Het
Ankrd36 C T 11: 5,579,312 (GRCm39) A192V probably benign Het
Apol7e A T 15: 77,601,803 (GRCm39) M134L probably benign Het
Atg9b A T 5: 24,591,107 (GRCm39) N774K probably benign Het
Catsperb T A 12: 101,560,596 (GRCm39) N862K possibly damaging Het
Ccdc7a T A 8: 129,646,948 (GRCm39) D648V probably damaging Het
Cfap54 G T 10: 92,790,934 (GRCm39) P1855T unknown Het
Clcnkb T A 4: 141,139,541 (GRCm39) T154S probably damaging Het
Cux1 C T 5: 136,279,454 (GRCm39) R609H probably damaging Het
Eif2ak4 A G 2: 118,252,667 (GRCm39) D413G possibly damaging Het
Elp1 A G 4: 56,771,453 (GRCm39) L948P probably damaging Het
Flnc T C 6: 29,443,501 (GRCm39) probably null Het
Grm5 T C 7: 87,765,498 (GRCm39) probably null Het
Hectd3 T G 4: 116,853,778 (GRCm39) F225V possibly damaging Het
Hpcal4 G T 4: 123,082,976 (GRCm39) M107I probably benign Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Larp4 C A 15: 99,908,339 (GRCm39) Q607K probably benign Het
Marchf8 A G 6: 116,378,815 (GRCm39) R250G probably benign Het
Med13 A C 11: 86,161,923 (GRCm39) N2135K probably damaging Het
Msh5 T A 17: 35,264,909 (GRCm39) R89* probably null Het
Musk T G 4: 58,286,051 (GRCm39) probably benign Het
Myo18b T C 5: 113,022,609 (GRCm39) Q261R unknown Het
Npr1 A T 3: 90,363,464 (GRCm39) probably benign Het
Or2l5 T C 16: 19,333,804 (GRCm39) Y194C possibly damaging Het
Or4c103 A T 2: 88,513,449 (GRCm39) F209Y probably benign Het
Or4f14c T A 2: 111,941,333 (GRCm39) K88M probably damaging Het
Or5w15 A T 2: 87,567,990 (GRCm39) L226Q probably damaging Het
Pcare G T 17: 72,058,372 (GRCm39) A435E probably benign Het
Pcdh9 T C 14: 94,126,086 (GRCm39) Y28C probably damaging Het
Pmpca G C 2: 26,285,046 (GRCm39) E424Q possibly damaging Het
Potefam1 T C 2: 111,059,877 (GRCm39) probably benign Het
Potefam3e T A 8: 19,784,775 (GRCm39) L203* probably null Het
Prkd1 T A 12: 50,435,191 (GRCm39) N512I probably benign Het
Pwwp2b C T 7: 138,836,326 (GRCm39) P589L probably damaging Het
Rasgrp4 G A 7: 28,842,452 (GRCm39) G242D probably damaging Het
Rcbtb1 T G 14: 59,467,973 (GRCm39) V480G probably damaging Het
Rptn A G 3: 93,305,501 (GRCm39) S945G probably benign Het
Slc22a2 C T 17: 12,824,863 (GRCm39) Q242* probably null Het
Slfn3 T A 11: 83,103,825 (GRCm39) V232E probably benign Het
Stab1 T A 14: 30,879,365 (GRCm39) K705M probably damaging Het
Syn2 C A 6: 115,255,128 (GRCm39) S480* probably null Het
Thsd4 A T 9: 60,301,728 (GRCm39) L189H probably damaging Het
Tinagl1 T C 4: 130,061,597 (GRCm39) T250A probably benign Het
Tnc A T 4: 63,935,683 (GRCm39) C418S probably damaging Het
Ube2q1 A G 3: 89,683,385 (GRCm39) E110G probably damaging Het
Wdfy4 G T 14: 32,693,722 (GRCm39) probably benign Het
Xcl1 T C 1: 164,759,419 (GRCm39) M94V probably benign Het
Zfp369 T C 13: 65,444,095 (GRCm39) S413P possibly damaging Het
Zfp454 A C 11: 50,764,595 (GRCm39) I279S possibly damaging Het
Zfp971 A C 2: 177,675,730 (GRCm39) Q443P probably damaging Het
Other mutations in Nynrin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Nynrin APN 14 56,105,905 (GRCm39) missense probably benign 0.38
IGL01131:Nynrin APN 14 56,110,142 (GRCm39) missense probably damaging 1.00
IGL01357:Nynrin APN 14 56,107,874 (GRCm39) missense probably benign
IGL01537:Nynrin APN 14 56,109,502 (GRCm39) missense possibly damaging 0.87
IGL01583:Nynrin APN 14 56,107,968 (GRCm39) missense probably damaging 1.00
IGL01726:Nynrin APN 14 56,101,611 (GRCm39) missense probably benign
IGL02161:Nynrin APN 14 56,101,441 (GRCm39) missense probably damaging 1.00
IGL02167:Nynrin APN 14 56,100,792 (GRCm39) missense probably damaging 1.00
IGL02247:Nynrin APN 14 56,109,167 (GRCm39) nonsense probably null
IGL02302:Nynrin APN 14 56,105,962 (GRCm39) missense probably benign 0.43
IGL02524:Nynrin APN 14 56,108,931 (GRCm39) missense possibly damaging 0.73
IGL02600:Nynrin APN 14 56,101,449 (GRCm39) missense probably benign 0.38
IGL02639:Nynrin APN 14 56,108,112 (GRCm39) missense probably damaging 1.00
IGL02654:Nynrin APN 14 56,100,716 (GRCm39) missense possibly damaging 0.95
IGL02659:Nynrin APN 14 56,103,554 (GRCm39) unclassified probably benign
IGL02736:Nynrin APN 14 56,108,366 (GRCm39) missense probably damaging 1.00
IGL02949:Nynrin APN 14 56,109,837 (GRCm39) missense probably damaging 0.99
PIT4458001:Nynrin UTSW 14 56,101,425 (GRCm39) missense probably benign 0.39
R0017:Nynrin UTSW 14 56,109,852 (GRCm39) missense probably damaging 1.00
R0078:Nynrin UTSW 14 56,100,789 (GRCm39) missense probably damaging 1.00
R0211:Nynrin UTSW 14 56,109,255 (GRCm39) missense probably benign 0.08
R0211:Nynrin UTSW 14 56,109,255 (GRCm39) missense probably benign 0.08
R0413:Nynrin UTSW 14 56,109,648 (GRCm39) missense possibly damaging 0.90
R0609:Nynrin UTSW 14 56,110,218 (GRCm39) missense probably damaging 1.00
R0626:Nynrin UTSW 14 56,105,492 (GRCm39) missense probably damaging 1.00
R1205:Nynrin UTSW 14 56,091,646 (GRCm39) intron probably benign
R1222:Nynrin UTSW 14 56,100,998 (GRCm39) missense probably benign 0.02
R1385:Nynrin UTSW 14 56,102,356 (GRCm39) missense probably benign 0.00
R1820:Nynrin UTSW 14 56,107,835 (GRCm39) missense possibly damaging 0.95
R1829:Nynrin UTSW 14 56,110,404 (GRCm39) missense possibly damaging 0.50
R1874:Nynrin UTSW 14 56,100,950 (GRCm39) missense probably benign 0.04
R1927:Nynrin UTSW 14 56,101,049 (GRCm39) missense probably benign 0.00
R2233:Nynrin UTSW 14 56,109,524 (GRCm39) missense possibly damaging 0.83
R3018:Nynrin UTSW 14 56,100,867 (GRCm39) missense probably benign 0.00
R3154:Nynrin UTSW 14 56,101,044 (GRCm39) missense possibly damaging 0.46
R3853:Nynrin UTSW 14 56,101,562 (GRCm39) missense probably benign 0.24
R4648:Nynrin UTSW 14 56,110,351 (GRCm39) nonsense probably null
R4722:Nynrin UTSW 14 56,091,852 (GRCm39) missense probably damaging 0.97
R4735:Nynrin UTSW 14 56,107,625 (GRCm39) missense probably benign 0.03
R4736:Nynrin UTSW 14 56,101,454 (GRCm39) missense probably damaging 1.00
R4780:Nynrin UTSW 14 56,100,720 (GRCm39) missense probably damaging 1.00
R4804:Nynrin UTSW 14 56,102,326 (GRCm39) missense probably benign
R4816:Nynrin UTSW 14 56,109,458 (GRCm39) missense probably damaging 1.00
R5307:Nynrin UTSW 14 56,101,263 (GRCm39) missense probably damaging 1.00
R5372:Nynrin UTSW 14 56,105,948 (GRCm39) missense probably benign 0.01
R5432:Nynrin UTSW 14 56,101,923 (GRCm39) missense possibly damaging 0.80
R5800:Nynrin UTSW 14 56,108,088 (GRCm39) missense probably damaging 1.00
R5825:Nynrin UTSW 14 56,101,683 (GRCm39) missense probably benign 0.00
R6149:Nynrin UTSW 14 56,091,780 (GRCm39) missense possibly damaging 0.83
R6244:Nynrin UTSW 14 56,105,485 (GRCm39) missense probably damaging 1.00
R6350:Nynrin UTSW 14 56,105,533 (GRCm39) missense probably benign 0.19
R6379:Nynrin UTSW 14 56,107,848 (GRCm39) missense probably damaging 1.00
R6437:Nynrin UTSW 14 56,109,227 (GRCm39) missense probably benign 0.00
R6501:Nynrin UTSW 14 56,100,989 (GRCm39) missense probably benign
R6702:Nynrin UTSW 14 56,101,935 (GRCm39) missense possibly damaging 0.80
R6703:Nynrin UTSW 14 56,101,935 (GRCm39) missense possibly damaging 0.80
R6907:Nynrin UTSW 14 56,101,335 (GRCm39) missense probably benign 0.20
R6908:Nynrin UTSW 14 56,101,335 (GRCm39) missense probably benign 0.20
R6928:Nynrin UTSW 14 56,101,335 (GRCm39) missense probably benign 0.20
R6934:Nynrin UTSW 14 56,101,335 (GRCm39) missense probably benign 0.20
R6935:Nynrin UTSW 14 56,101,335 (GRCm39) missense probably benign 0.20
R7197:Nynrin UTSW 14 56,109,380 (GRCm39) missense probably benign 0.00
R7204:Nynrin UTSW 14 56,110,190 (GRCm39) missense probably damaging 1.00
R7272:Nynrin UTSW 14 56,107,872 (GRCm39) missense probably damaging 1.00
R7335:Nynrin UTSW 14 56,101,371 (GRCm39) missense probably benign
R7361:Nynrin UTSW 14 56,107,857 (GRCm39) missense possibly damaging 0.71
R7368:Nynrin UTSW 14 56,107,968 (GRCm39) missense probably damaging 1.00
R7443:Nynrin UTSW 14 56,108,873 (GRCm39) missense probably benign 0.18
R7584:Nynrin UTSW 14 56,109,041 (GRCm39) missense probably damaging 1.00
R7677:Nynrin UTSW 14 56,107,693 (GRCm39) missense probably benign
R7723:Nynrin UTSW 14 56,109,502 (GRCm39) missense possibly damaging 0.87
R7776:Nynrin UTSW 14 56,103,420 (GRCm39) missense probably damaging 1.00
R7787:Nynrin UTSW 14 56,107,980 (GRCm39) missense probably benign
R7842:Nynrin UTSW 14 56,102,553 (GRCm39) missense probably damaging 1.00
R7852:Nynrin UTSW 14 56,108,886 (GRCm39) missense probably damaging 0.96
R8040:Nynrin UTSW 14 56,108,982 (GRCm39) missense probably benign 0.01
R8159:Nynrin UTSW 14 56,102,517 (GRCm39) missense probably benign
R8159:Nynrin UTSW 14 56,100,587 (GRCm39) missense probably damaging 0.99
R8258:Nynrin UTSW 14 56,100,815 (GRCm39) missense possibly damaging 0.95
R8259:Nynrin UTSW 14 56,100,815 (GRCm39) missense possibly damaging 0.95
R8343:Nynrin UTSW 14 56,101,248 (GRCm39) missense probably benign
R8504:Nynrin UTSW 14 56,107,703 (GRCm39) missense probably benign 0.01
R8691:Nynrin UTSW 14 56,110,106 (GRCm39) missense probably damaging 1.00
R8777:Nynrin UTSW 14 56,109,120 (GRCm39) missense probably benign
R8777-TAIL:Nynrin UTSW 14 56,109,120 (GRCm39) missense probably benign
R9041:Nynrin UTSW 14 56,108,753 (GRCm39) missense possibly damaging 0.83
R9346:Nynrin UTSW 14 56,100,495 (GRCm39) missense probably benign 0.01
R9366:Nynrin UTSW 14 56,100,587 (GRCm39) missense probably damaging 0.99
R9690:Nynrin UTSW 14 56,108,204 (GRCm39) missense probably benign 0.00
RF007:Nynrin UTSW 14 56,103,658 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- AACTGAGTGATGACGCTGAC -3'
(R):5'- GGCCCACGAGATCTTCATAGTC -3'

Sequencing Primer
(F):5'- ACGCCGAACCTTTGGAGGATC -3'
(R):5'- TCATAGTCAGAGATAACATCCCGGTG -3'
Posted On 2021-03-08