Incidental Mutation 'R8671:Rcbtb1'
ID 661177
Institutional Source Beutler Lab
Gene Symbol Rcbtb1
Ensembl Gene ENSMUSG00000035469
Gene Name regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock # R8671 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 59201209-59237265 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 59230524 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 480 (V480G)
Ref Sequence ENSEMBL: ENSMUSP00000022551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022551] [ENSMUST00000043227] [ENSMUST00000172810] [ENSMUST00000174009]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000022551
AA Change: V480G

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022551
Gene: ENSMUSG00000035469
AA Change: V480G

DomainStartEndE-ValueType
Pfam:RCC1 40 89 3.9e-8 PFAM
Pfam:RCC1 93 143 2e-13 PFAM
Pfam:RCC1_2 130 159 5.7e-12 PFAM
Pfam:RCC1 146 196 2.2e-13 PFAM
Pfam:RCC1_2 183 212 3.2e-8 PFAM
Pfam:RCC1 199 248 5.3e-17 PFAM
Pfam:RCC1_2 235 264 2.2e-11 PFAM
Pfam:RCC1 251 300 2.3e-15 PFAM
BTB 370 467 4.14e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000043227
AA Change: V480G

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037030
Gene: ENSMUSG00000035469
AA Change: V480G

DomainStartEndE-ValueType
Pfam:RCC1 40 88 3.2e-7 PFAM
Pfam:RCC1 93 143 2.6e-13 PFAM
Pfam:RCC1_2 130 159 3.7e-12 PFAM
Pfam:RCC1 146 196 3.8e-14 PFAM
Pfam:RCC1_2 183 212 6.5e-8 PFAM
Pfam:RCC1 199 248 1.3e-16 PFAM
Pfam:RCC1_2 235 264 3.5e-10 PFAM
Pfam:RCC1 251 300 1.2e-13 PFAM
BTB 370 467 4.14e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172810
Predicted Effect probably benign
Transcript: ENSMUST00000174009
Predicted Effect probably benign
Transcript: ENSMUST00000174830
SMART Domains Protein: ENSMUSP00000133421
Gene: ENSMUSG00000035469

DomainStartEndE-ValueType
Pfam:RCC1 1 48 2e-12 PFAM
Pfam:RCC1_2 33 64 4.8e-13 PFAM
Pfam:RCC1 51 93 7.8e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with an N-terminal RCC1 domain and a C-terminal BTB (broad complex, tramtrack and bric-a-brac) domain. In rat, over-expression of this gene in vascular smooth muscle cells induced cellular hypertrophy. In rat, the C-terminus of RCBTB1 interacts with the angiotensin II receptor-1A. In humans, this gene maps to a region of chromosome 13q that is frequently deleted in B-cell chronic lymphocytic leukemia and other lymphoid malignancies. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik C T 4: 73,942,929 E145K probably damaging Het
4930430A15Rik T C 2: 111,229,532 probably benign Het
4930467E23Rik T A 8: 19,734,759 L203* probably null Het
Ambp A T 4: 63,150,419 Y120* probably null Het
Ankrd36 C T 11: 5,629,312 A192V probably benign Het
Apol7e A T 15: 77,717,603 M134L probably benign Het
Atg9b A T 5: 24,386,109 N774K probably benign Het
BC027072 G T 17: 71,751,377 A435E probably benign Het
Catsperb T A 12: 101,594,337 N862K possibly damaging Het
Ccdc7a T A 8: 128,920,467 D648V probably damaging Het
Cfap54 G T 10: 92,955,072 P1855T unknown Het
Clcnkb T A 4: 141,412,230 T154S probably damaging Het
Cux1 C T 5: 136,250,600 R609H probably damaging Het
Eif2ak4 A G 2: 118,422,186 D413G possibly damaging Het
Flnc T C 6: 29,443,502 probably null Het
Grm5 T C 7: 88,116,290 probably null Het
Hectd3 T G 4: 116,996,581 F225V possibly damaging Het
Hpcal4 G T 4: 123,189,183 M107I probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ikbkap A G 4: 56,771,453 L948P probably damaging Het
Larp4 C A 15: 100,010,458 Q607K probably benign Het
March8 A G 6: 116,401,854 R250G probably benign Het
Med13 A C 11: 86,271,097 N2135K probably damaging Het
Msh5 T A 17: 35,045,933 R89* probably null Het
Musk T G 4: 58,286,051 probably benign Het
Myo18b T C 5: 112,874,743 Q261R unknown Het
Npr1 A T 3: 90,456,157 probably benign Het
Nynrin T A 14: 55,870,442 V1002E possibly damaging Het
Olfr1138 A T 2: 87,737,646 L226Q probably damaging Het
Olfr1195 A T 2: 88,683,105 F209Y probably benign Het
Olfr1315-ps1 T A 2: 112,110,988 K88M probably damaging Het
Olfr167 T C 16: 19,515,054 Y194C possibly damaging Het
Pcdh9 T C 14: 93,888,650 Y28C probably damaging Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Prkd1 T A 12: 50,388,408 N512I probably benign Het
Pwwp2b C T 7: 139,256,410 P589L probably damaging Het
Rasgrp4 G A 7: 29,143,027 G242D probably damaging Het
Rptn A G 3: 93,398,194 S945G probably benign Het
Slc22a2 C T 17: 12,605,976 Q242* probably null Het
Slfn3 T A 11: 83,212,999 V232E probably benign Het
Stab1 T A 14: 31,157,408 K705M probably damaging Het
Syn2 C A 6: 115,278,167 S480* probably null Het
Thsd4 A T 9: 60,394,445 L189H probably damaging Het
Tinagl1 T C 4: 130,167,804 T250A probably benign Het
Tnc A T 4: 64,017,446 C418S probably damaging Het
Ube2q1 A G 3: 89,776,078 E110G probably damaging Het
Wdfy4 G T 14: 32,971,765 probably benign Het
Xcl1 T C 1: 164,931,850 M94V probably benign Het
Zfp369 T C 13: 65,296,281 S413P possibly damaging Het
Zfp454 A C 11: 50,873,768 I279S possibly damaging Het
Zfp971 A C 2: 178,033,937 Q443P probably damaging Het
Other mutations in Rcbtb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Rcbtb1 APN 14 59228305 missense probably benign 0.19
IGL01954:Rcbtb1 APN 14 59229967 missense probably damaging 1.00
IGL02458:Rcbtb1 APN 14 59229994 missense probably damaging 1.00
IGL02632:Rcbtb1 APN 14 59224682 missense probably damaging 0.99
IGL02689:Rcbtb1 APN 14 59224700 missense probably damaging 1.00
IGL03201:Rcbtb1 APN 14 59223278 missense probably damaging 1.00
IGL03411:Rcbtb1 APN 14 59209970 start codon destroyed probably null 1.00
R0014:Rcbtb1 UTSW 14 59235242 missense probably benign 0.35
R2858:Rcbtb1 UTSW 14 59221412 splice site probably null
R2877:Rcbtb1 UTSW 14 59210592 splice site probably benign
R3890:Rcbtb1 UTSW 14 59228355 missense possibly damaging 0.67
R3892:Rcbtb1 UTSW 14 59228355 missense possibly damaging 0.67
R3945:Rcbtb1 UTSW 14 59224776 critical splice donor site probably null
R6869:Rcbtb1 UTSW 14 59217602 missense probably benign 0.01
R7224:Rcbtb1 UTSW 14 59228379 missense probably damaging 1.00
R7910:Rcbtb1 UTSW 14 59236678 missense unknown
R7962:Rcbtb1 UTSW 14 59221567 missense probably benign 0.11
R8532:Rcbtb1 UTSW 14 59210524 nonsense probably null
R8676:Rcbtb1 UTSW 14 59229952 missense possibly damaging 0.50
R9066:Rcbtb1 UTSW 14 59224757 missense possibly damaging 0.50
R9310:Rcbtb1 UTSW 14 59235250 missense probably benign 0.05
R9780:Rcbtb1 UTSW 14 59228347 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCTGCTGGCCATGAAATGC -3'
(R):5'- CAGTTCCTTAGAAGCAAAGCAGAC -3'

Sequencing Primer
(F):5'- CCATGAAATGCCCGTGTTGTCAG -3'
(R):5'- GCAGACAAACAATGATTCTGACTGTG -3'
Posted On 2021-03-08