Incidental Mutation 'R8671:Larp4'
ID 661180
Institutional Source Beutler Lab
Gene Symbol Larp4
Ensembl Gene ENSMUSG00000023025
Gene Name La ribonucleoprotein 4
Synonyms D330037H05Rik
MMRRC Submission 068526-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.413) question?
Stock # R8671 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 99867946-99914239 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 99908339 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 607 (Q607K)
Ref Sequence ENSEMBL: ENSMUSP00000097780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057632] [ENSMUST00000100206] [ENSMUST00000230521] [ENSMUST00000230956] [ENSMUST00000231160]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000057632
AA Change: Q606K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000086964
Gene: ENSMUSG00000023025
AA Change: Q606K

DomainStartEndE-ValueType
LA 112 190 2.44e-40 SMART
RRM 195 265 3.28e-2 SMART
low complexity region 375 388 N/A INTRINSIC
low complexity region 433 453 N/A INTRINSIC
low complexity region 457 470 N/A INTRINSIC
low complexity region 651 663 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100206
AA Change: Q607K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000097780
Gene: ENSMUSG00000023025
AA Change: Q607K

DomainStartEndE-ValueType
LA 113 191 2.44e-40 SMART
RRM 196 266 3.28e-2 SMART
low complexity region 376 389 N/A INTRINSIC
low complexity region 434 454 N/A INTRINSIC
low complexity region 458 471 N/A INTRINSIC
low complexity region 652 664 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000230521
Predicted Effect probably damaging
Transcript: ENSMUST00000230956
AA Change: Q608K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000231160
AA Change: Q548K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik C T 4: 73,861,166 (GRCm39) E145K probably damaging Het
Ambp A T 4: 63,068,656 (GRCm39) Y120* probably null Het
Ankrd36 C T 11: 5,579,312 (GRCm39) A192V probably benign Het
Apol7e A T 15: 77,601,803 (GRCm39) M134L probably benign Het
Atg9b A T 5: 24,591,107 (GRCm39) N774K probably benign Het
Catsperb T A 12: 101,560,596 (GRCm39) N862K possibly damaging Het
Ccdc7a T A 8: 129,646,948 (GRCm39) D648V probably damaging Het
Cfap54 G T 10: 92,790,934 (GRCm39) P1855T unknown Het
Clcnkb T A 4: 141,139,541 (GRCm39) T154S probably damaging Het
Cux1 C T 5: 136,279,454 (GRCm39) R609H probably damaging Het
Eif2ak4 A G 2: 118,252,667 (GRCm39) D413G possibly damaging Het
Elp1 A G 4: 56,771,453 (GRCm39) L948P probably damaging Het
Flnc T C 6: 29,443,501 (GRCm39) probably null Het
Grm5 T C 7: 87,765,498 (GRCm39) probably null Het
Hectd3 T G 4: 116,853,778 (GRCm39) F225V possibly damaging Het
Hpcal4 G T 4: 123,082,976 (GRCm39) M107I probably benign Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Marchf8 A G 6: 116,378,815 (GRCm39) R250G probably benign Het
Med13 A C 11: 86,161,923 (GRCm39) N2135K probably damaging Het
Msh5 T A 17: 35,264,909 (GRCm39) R89* probably null Het
Musk T G 4: 58,286,051 (GRCm39) probably benign Het
Myo18b T C 5: 113,022,609 (GRCm39) Q261R unknown Het
Npr1 A T 3: 90,363,464 (GRCm39) probably benign Het
Nynrin T A 14: 56,107,899 (GRCm39) V1002E possibly damaging Het
Or2l5 T C 16: 19,333,804 (GRCm39) Y194C possibly damaging Het
Or4c103 A T 2: 88,513,449 (GRCm39) F209Y probably benign Het
Or4f14c T A 2: 111,941,333 (GRCm39) K88M probably damaging Het
Or5w15 A T 2: 87,567,990 (GRCm39) L226Q probably damaging Het
Pcare G T 17: 72,058,372 (GRCm39) A435E probably benign Het
Pcdh9 T C 14: 94,126,086 (GRCm39) Y28C probably damaging Het
Pmpca G C 2: 26,285,046 (GRCm39) E424Q possibly damaging Het
Potefam1 T C 2: 111,059,877 (GRCm39) probably benign Het
Potefam3e T A 8: 19,784,775 (GRCm39) L203* probably null Het
Prkd1 T A 12: 50,435,191 (GRCm39) N512I probably benign Het
Pwwp2b C T 7: 138,836,326 (GRCm39) P589L probably damaging Het
Rasgrp4 G A 7: 28,842,452 (GRCm39) G242D probably damaging Het
Rcbtb1 T G 14: 59,467,973 (GRCm39) V480G probably damaging Het
Rptn A G 3: 93,305,501 (GRCm39) S945G probably benign Het
Slc22a2 C T 17: 12,824,863 (GRCm39) Q242* probably null Het
Slfn3 T A 11: 83,103,825 (GRCm39) V232E probably benign Het
Stab1 T A 14: 30,879,365 (GRCm39) K705M probably damaging Het
Syn2 C A 6: 115,255,128 (GRCm39) S480* probably null Het
Thsd4 A T 9: 60,301,728 (GRCm39) L189H probably damaging Het
Tinagl1 T C 4: 130,061,597 (GRCm39) T250A probably benign Het
Tnc A T 4: 63,935,683 (GRCm39) C418S probably damaging Het
Ube2q1 A G 3: 89,683,385 (GRCm39) E110G probably damaging Het
Wdfy4 G T 14: 32,693,722 (GRCm39) probably benign Het
Xcl1 T C 1: 164,759,419 (GRCm39) M94V probably benign Het
Zfp369 T C 13: 65,444,095 (GRCm39) S413P possibly damaging Het
Zfp454 A C 11: 50,764,595 (GRCm39) I279S possibly damaging Het
Zfp971 A C 2: 177,675,730 (GRCm39) Q443P probably damaging Het
Other mutations in Larp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Larp4 APN 15 99,885,302 (GRCm39) missense probably damaging 0.98
IGL01668:Larp4 APN 15 99,885,355 (GRCm39) missense probably damaging 1.00
IGL01687:Larp4 APN 15 99,894,369 (GRCm39) missense probably damaging 1.00
IGL02105:Larp4 APN 15 99,883,952 (GRCm39) missense probably damaging 1.00
IGL02676:Larp4 APN 15 99,888,302 (GRCm39) missense possibly damaging 0.94
IGL03286:Larp4 APN 15 99,883,967 (GRCm39) missense probably damaging 1.00
Skewer UTSW 15 99,905,611 (GRCm39) critical splice donor site probably null
R1076:Larp4 UTSW 15 99,895,311 (GRCm39) missense probably benign 0.00
R1996:Larp4 UTSW 15 99,882,844 (GRCm39) missense probably damaging 1.00
R2183:Larp4 UTSW 15 99,909,778 (GRCm39) missense probably benign 0.16
R2260:Larp4 UTSW 15 99,895,277 (GRCm39) missense possibly damaging 0.95
R3777:Larp4 UTSW 15 99,888,238 (GRCm39) missense probably damaging 1.00
R3916:Larp4 UTSW 15 99,888,284 (GRCm39) missense probably benign 0.00
R3962:Larp4 UTSW 15 99,910,026 (GRCm39) missense probably damaging 1.00
R5059:Larp4 UTSW 15 99,903,171 (GRCm39) missense probably damaging 1.00
R5081:Larp4 UTSW 15 99,870,898 (GRCm39) intron probably benign
R5104:Larp4 UTSW 15 99,883,964 (GRCm39) missense probably damaging 1.00
R5409:Larp4 UTSW 15 99,883,945 (GRCm39) missense probably damaging 0.98
R5436:Larp4 UTSW 15 99,883,995 (GRCm39) missense probably damaging 0.98
R6895:Larp4 UTSW 15 99,905,611 (GRCm39) critical splice donor site probably null
R7316:Larp4 UTSW 15 99,898,898 (GRCm39) missense probably benign
R7483:Larp4 UTSW 15 99,889,659 (GRCm39) missense probably benign 0.01
R7510:Larp4 UTSW 15 99,891,258 (GRCm39) missense probably benign 0.07
R8131:Larp4 UTSW 15 99,892,570 (GRCm39) missense probably damaging 0.99
R8263:Larp4 UTSW 15 99,883,961 (GRCm39) missense probably benign 0.00
R8322:Larp4 UTSW 15 99,908,237 (GRCm39) missense probably benign 0.01
R9059:Larp4 UTSW 15 99,889,693 (GRCm39) missense probably benign 0.26
R9151:Larp4 UTSW 15 99,888,205 (GRCm39) missense possibly damaging 0.88
R9444:Larp4 UTSW 15 99,909,807 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTTCTTTAGCACGACTCAGCAAG -3'
(R):5'- TACATGACAATGTGCCATGTTG -3'

Sequencing Primer
(F):5'- CTCAGCAAGAGCAGGATCAG -3'
(R):5'- AAGCTGCTCTTAGACAGGC -3'
Posted On 2021-03-08