Incidental Mutation 'R8671:Olfr167'
ID 661181
Institutional Source Beutler Lab
Gene Symbol Olfr167
Ensembl Gene ENSMUSG00000045341
Gene Name olfactory receptor 167
Synonyms MOR272-1, GA_x54KRFPKG5P-15963726-15962788
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock # R8671 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 19509558-19522266 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 19515054 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 194 (Y194C)
Ref Sequence ENSEMBL: ENSMUSP00000150102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054606] [ENSMUST00000214315]
AlphaFold Q8VGJ5
Predicted Effect possibly damaging
Transcript: ENSMUST00000054606
AA Change: Y194C

PolyPhen 2 Score 0.634 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000055344
Gene: ENSMUSG00000045341
AA Change: Y194C

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 4.8e-46 PFAM
Pfam:7TM_GPCR_Srsx 33 295 1.2e-6 PFAM
Pfam:7tm_1 40 289 1.8e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214315
AA Change: Y194C

PolyPhen 2 Score 0.634 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik C T 4: 73,942,929 E145K probably damaging Het
4930430A15Rik T C 2: 111,229,532 probably benign Het
4930467E23Rik T A 8: 19,734,759 L203* probably null Het
Ambp A T 4: 63,150,419 Y120* probably null Het
Ankrd36 C T 11: 5,629,312 A192V probably benign Het
Apol7e A T 15: 77,717,603 M134L probably benign Het
Atg9b A T 5: 24,386,109 N774K probably benign Het
BC027072 G T 17: 71,751,377 A435E probably benign Het
Catsperb T A 12: 101,594,337 N862K possibly damaging Het
Ccdc7a T A 8: 128,920,467 D648V probably damaging Het
Cfap54 G T 10: 92,955,072 P1855T unknown Het
Clcnkb T A 4: 141,412,230 T154S probably damaging Het
Cux1 C T 5: 136,250,600 R609H probably damaging Het
Eif2ak4 A G 2: 118,422,186 D413G possibly damaging Het
Flnc T C 6: 29,443,502 probably null Het
Grm5 T C 7: 88,116,290 probably null Het
Hectd3 T G 4: 116,996,581 F225V possibly damaging Het
Hpcal4 G T 4: 123,189,183 M107I probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ikbkap A G 4: 56,771,453 L948P probably damaging Het
Larp4 C A 15: 100,010,458 Q607K probably benign Het
March8 A G 6: 116,401,854 R250G probably benign Het
Med13 A C 11: 86,271,097 N2135K probably damaging Het
Msh5 T A 17: 35,045,933 R89* probably null Het
Musk T G 4: 58,286,051 probably benign Het
Myo18b T C 5: 112,874,743 Q261R unknown Het
Npr1 A T 3: 90,456,157 probably benign Het
Nynrin T A 14: 55,870,442 V1002E possibly damaging Het
Olfr1138 A T 2: 87,737,646 L226Q probably damaging Het
Olfr1195 A T 2: 88,683,105 F209Y probably benign Het
Olfr1315-ps1 T A 2: 112,110,988 K88M probably damaging Het
Pcdh9 T C 14: 93,888,650 Y28C probably damaging Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Prkd1 T A 12: 50,388,408 N512I probably benign Het
Pwwp2b C T 7: 139,256,410 P589L probably damaging Het
Rasgrp4 G A 7: 29,143,027 G242D probably damaging Het
Rcbtb1 T G 14: 59,230,524 V480G probably damaging Het
Rptn A G 3: 93,398,194 S945G probably benign Het
Slc22a2 C T 17: 12,605,976 Q242* probably null Het
Slfn3 T A 11: 83,212,999 V232E probably benign Het
Stab1 T A 14: 31,157,408 K705M probably damaging Het
Syn2 C A 6: 115,278,167 S480* probably null Het
Thsd4 A T 9: 60,394,445 L189H probably damaging Het
Tinagl1 T C 4: 130,167,804 T250A probably benign Het
Tnc A T 4: 64,017,446 C418S probably damaging Het
Ube2q1 A G 3: 89,776,078 E110G probably damaging Het
Wdfy4 G T 14: 32,971,765 probably benign Het
Xcl1 T C 1: 164,931,850 M94V probably benign Het
Zfp369 T C 13: 65,296,281 S413P possibly damaging Het
Zfp454 A C 11: 50,873,768 I279S possibly damaging Het
Zfp971 A C 2: 178,033,937 Q443P probably damaging Het
Other mutations in Olfr167
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01535:Olfr167 APN 16 19515478 missense probably benign 0.01
IGL02115:Olfr167 APN 16 19515103 missense probably damaging 1.00
IGL02562:Olfr167 APN 16 19514964 missense possibly damaging 0.74
BB008:Olfr167 UTSW 16 19515508 missense possibly damaging 0.94
BB018:Olfr167 UTSW 16 19515508 missense possibly damaging 0.94
R0366:Olfr167 UTSW 16 19514848 missense probably benign 0.13
R0673:Olfr167 UTSW 16 19515396 missense probably damaging 1.00
R1187:Olfr167 UTSW 16 19515046 missense probably benign 0.01
R1237:Olfr167 UTSW 16 19515625 missense probably benign 0.01
R1975:Olfr167 UTSW 16 19514836 missense probably damaging 0.99
R1977:Olfr167 UTSW 16 19514836 missense probably damaging 0.99
R1997:Olfr167 UTSW 16 19515042 missense probably damaging 1.00
R2225:Olfr167 UTSW 16 19515246 missense probably benign 0.05
R2226:Olfr167 UTSW 16 19515246 missense probably benign 0.05
R4078:Olfr167 UTSW 16 19515232 missense possibly damaging 0.76
R5019:Olfr167 UTSW 16 19515535 missense probably damaging 0.99
R5071:Olfr167 UTSW 16 19515027 missense probably benign 0.00
R5278:Olfr167 UTSW 16 19515378 nonsense probably null
R5415:Olfr167 UTSW 16 19515246 missense possibly damaging 0.94
R5744:Olfr167 UTSW 16 19515336 missense probably benign 0.00
R5991:Olfr167 UTSW 16 19514757 missense probably damaging 0.99
R6151:Olfr167 UTSW 16 19515531 missense probably damaging 1.00
R6540:Olfr167 UTSW 16 19514821 missense probably benign
R7014:Olfr167 UTSW 16 19515456 missense probably benign 0.20
R7145:Olfr167 UTSW 16 19514899 missense probably damaging 0.99
R7535:Olfr167 UTSW 16 19514794 missense probably damaging 1.00
R7677:Olfr167 UTSW 16 19514928 missense probably benign 0.42
R7715:Olfr167 UTSW 16 19514730 missense probably benign 0.00
R7931:Olfr167 UTSW 16 19515508 missense possibly damaging 0.94
R8137:Olfr167 UTSW 16 19515096 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGGTGCGTAGTAGAAAGTTACAAC -3'
(R):5'- ATGGCCTATGACCGTTATGTGG -3'

Sequencing Primer
(F):5'- TTACAACAGTGAGGTGAGTGCTAC -3'
(R):5'- GCCACACATATGAATAAAAGAGTCTG -3'
Posted On 2021-03-08