Incidental Mutation 'R8671:Slc22a2'
ID 661182
Institutional Source Beutler Lab
Gene Symbol Slc22a2
Ensembl Gene ENSMUSG00000040966
Gene Name solute carrier family 22 (organic cation transporter), member 2
Synonyms Oct2, Orct2
MMRRC Submission 068526-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8671 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 12803076-12847376 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 12824863 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 242 (Q242*)
Ref Sequence ENSEMBL: ENSMUSP00000041186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046959]
AlphaFold O70577
Predicted Effect probably null
Transcript: ENSMUST00000046959
AA Change: Q242*
SMART Domains Protein: ENSMUSP00000041186
Gene: ENSMUSG00000040966
AA Change: Q242*

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Sugar_tr 80 528 7.6e-37 PFAM
Pfam:MFS_1 134 398 3.5e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. This gene is one of three similar cation transporter genes located in a cluster on chromosome 6. The encoded protein contains twelve putative transmembrane domains and is a plasma integral membrane protein. It is found primarily in the kidney, where it may mediate the first step in cation reabsorption. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knockout allele are viable and fertile and display no obvious phenotypic abnormalities. No significant defects in the renal secretion of a model organic cation are observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik C T 4: 73,861,166 (GRCm39) E145K probably damaging Het
Ambp A T 4: 63,068,656 (GRCm39) Y120* probably null Het
Ankrd36 C T 11: 5,579,312 (GRCm39) A192V probably benign Het
Apol7e A T 15: 77,601,803 (GRCm39) M134L probably benign Het
Atg9b A T 5: 24,591,107 (GRCm39) N774K probably benign Het
Catsperb T A 12: 101,560,596 (GRCm39) N862K possibly damaging Het
Ccdc7a T A 8: 129,646,948 (GRCm39) D648V probably damaging Het
Cfap54 G T 10: 92,790,934 (GRCm39) P1855T unknown Het
Clcnkb T A 4: 141,139,541 (GRCm39) T154S probably damaging Het
Cux1 C T 5: 136,279,454 (GRCm39) R609H probably damaging Het
Eif2ak4 A G 2: 118,252,667 (GRCm39) D413G possibly damaging Het
Elp1 A G 4: 56,771,453 (GRCm39) L948P probably damaging Het
Flnc T C 6: 29,443,501 (GRCm39) probably null Het
Grm5 T C 7: 87,765,498 (GRCm39) probably null Het
Hectd3 T G 4: 116,853,778 (GRCm39) F225V possibly damaging Het
Hpcal4 G T 4: 123,082,976 (GRCm39) M107I probably benign Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Larp4 C A 15: 99,908,339 (GRCm39) Q607K probably benign Het
Marchf8 A G 6: 116,378,815 (GRCm39) R250G probably benign Het
Med13 A C 11: 86,161,923 (GRCm39) N2135K probably damaging Het
Msh5 T A 17: 35,264,909 (GRCm39) R89* probably null Het
Musk T G 4: 58,286,051 (GRCm39) probably benign Het
Myo18b T C 5: 113,022,609 (GRCm39) Q261R unknown Het
Npr1 A T 3: 90,363,464 (GRCm39) probably benign Het
Nynrin T A 14: 56,107,899 (GRCm39) V1002E possibly damaging Het
Or2l5 T C 16: 19,333,804 (GRCm39) Y194C possibly damaging Het
Or4c103 A T 2: 88,513,449 (GRCm39) F209Y probably benign Het
Or4f14c T A 2: 111,941,333 (GRCm39) K88M probably damaging Het
Or5w15 A T 2: 87,567,990 (GRCm39) L226Q probably damaging Het
Pcare G T 17: 72,058,372 (GRCm39) A435E probably benign Het
Pcdh9 T C 14: 94,126,086 (GRCm39) Y28C probably damaging Het
Pmpca G C 2: 26,285,046 (GRCm39) E424Q possibly damaging Het
Potefam1 T C 2: 111,059,877 (GRCm39) probably benign Het
Potefam3e T A 8: 19,784,775 (GRCm39) L203* probably null Het
Prkd1 T A 12: 50,435,191 (GRCm39) N512I probably benign Het
Pwwp2b C T 7: 138,836,326 (GRCm39) P589L probably damaging Het
Rasgrp4 G A 7: 28,842,452 (GRCm39) G242D probably damaging Het
Rcbtb1 T G 14: 59,467,973 (GRCm39) V480G probably damaging Het
Rptn A G 3: 93,305,501 (GRCm39) S945G probably benign Het
Slfn3 T A 11: 83,103,825 (GRCm39) V232E probably benign Het
Stab1 T A 14: 30,879,365 (GRCm39) K705M probably damaging Het
Syn2 C A 6: 115,255,128 (GRCm39) S480* probably null Het
Thsd4 A T 9: 60,301,728 (GRCm39) L189H probably damaging Het
Tinagl1 T C 4: 130,061,597 (GRCm39) T250A probably benign Het
Tnc A T 4: 63,935,683 (GRCm39) C418S probably damaging Het
Ube2q1 A G 3: 89,683,385 (GRCm39) E110G probably damaging Het
Wdfy4 G T 14: 32,693,722 (GRCm39) probably benign Het
Xcl1 T C 1: 164,759,419 (GRCm39) M94V probably benign Het
Zfp369 T C 13: 65,444,095 (GRCm39) S413P possibly damaging Het
Zfp454 A C 11: 50,764,595 (GRCm39) I279S possibly damaging Het
Zfp971 A C 2: 177,675,730 (GRCm39) Q443P probably damaging Het
Other mutations in Slc22a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Slc22a2 APN 17 12,827,305 (GRCm39) missense possibly damaging 0.79
IGL00658:Slc22a2 APN 17 12,834,202 (GRCm39) missense probably benign 0.37
IGL01073:Slc22a2 APN 17 12,803,236 (GRCm39) missense probably benign 0.00
IGL01573:Slc22a2 APN 17 12,824,848 (GRCm39) missense probably damaging 0.99
IGL02000:Slc22a2 APN 17 12,803,270 (GRCm39) missense possibly damaging 0.77
IGL02943:Slc22a2 APN 17 12,828,948 (GRCm39) missense probably damaging 1.00
IGL03301:Slc22a2 APN 17 12,824,926 (GRCm39) missense probably damaging 1.00
R0492:Slc22a2 UTSW 17 12,834,159 (GRCm39) missense probably benign 0.00
R0835:Slc22a2 UTSW 17 12,831,318 (GRCm39) missense probably benign 0.01
R1330:Slc22a2 UTSW 17 12,805,699 (GRCm39) missense possibly damaging 0.94
R1432:Slc22a2 UTSW 17 12,803,195 (GRCm39) missense possibly damaging 0.89
R1559:Slc22a2 UTSW 17 12,803,298 (GRCm39) missense probably damaging 1.00
R1855:Slc22a2 UTSW 17 12,805,699 (GRCm39) missense probably damaging 0.99
R1884:Slc22a2 UTSW 17 12,833,713 (GRCm39) splice site probably benign
R2042:Slc22a2 UTSW 17 12,818,012 (GRCm39) missense probably benign 0.01
R2197:Slc22a2 UTSW 17 12,817,949 (GRCm39) missense probably damaging 1.00
R2255:Slc22a2 UTSW 17 12,818,062 (GRCm39) missense probably damaging 1.00
R2271:Slc22a2 UTSW 17 12,805,692 (GRCm39) missense probably benign
R4003:Slc22a2 UTSW 17 12,831,337 (GRCm39) missense probably benign 0.01
R4021:Slc22a2 UTSW 17 12,803,376 (GRCm39) missense probably damaging 1.00
R4093:Slc22a2 UTSW 17 12,831,281 (GRCm39) missense probably damaging 1.00
R4404:Slc22a2 UTSW 17 12,833,651 (GRCm39) missense probably damaging 1.00
R4419:Slc22a2 UTSW 17 12,831,473 (GRCm39) nonsense probably null
R4564:Slc22a2 UTSW 17 12,828,943 (GRCm39) missense probably benign 0.08
R4866:Slc22a2 UTSW 17 12,803,316 (GRCm39) missense probably damaging 1.00
R4877:Slc22a2 UTSW 17 12,833,702 (GRCm39) missense possibly damaging 0.53
R5224:Slc22a2 UTSW 17 12,805,719 (GRCm39) missense probably damaging 0.97
R5668:Slc22a2 UTSW 17 12,827,296 (GRCm39) missense probably benign
R6326:Slc22a2 UTSW 17 12,831,297 (GRCm39) nonsense probably null
R7137:Slc22a2 UTSW 17 12,803,228 (GRCm39) missense probably benign
R7211:Slc22a2 UTSW 17 12,805,770 (GRCm39) critical splice donor site probably null
R7378:Slc22a2 UTSW 17 12,831,278 (GRCm39) missense probably damaging 1.00
R7521:Slc22a2 UTSW 17 12,805,710 (GRCm39) missense probably benign 0.14
R7524:Slc22a2 UTSW 17 12,824,944 (GRCm39) missense possibly damaging 0.87
R7735:Slc22a2 UTSW 17 12,828,917 (GRCm39) missense probably damaging 0.99
R8136:Slc22a2 UTSW 17 12,824,917 (GRCm39) missense probably damaging 1.00
R8799:Slc22a2 UTSW 17 12,831,425 (GRCm39) missense probably benign 0.14
R8874:Slc22a2 UTSW 17 12,828,866 (GRCm39) missense probably benign 0.37
R9046:Slc22a2 UTSW 17 12,834,234 (GRCm39) missense probably null 0.15
R9220:Slc22a2 UTSW 17 12,838,757 (GRCm39) missense probably benign 0.03
R9367:Slc22a2 UTSW 17 12,824,837 (GRCm39) missense probably benign 0.19
R9410:Slc22a2 UTSW 17 12,805,732 (GRCm39) missense probably damaging 0.99
R9511:Slc22a2 UTSW 17 12,828,916 (GRCm39) missense probably damaging 0.98
R9580:Slc22a2 UTSW 17 12,803,177 (GRCm39) missense probably benign 0.00
Z1088:Slc22a2 UTSW 17 12,833,663 (GRCm39) missense probably benign 0.36
Z1176:Slc22a2 UTSW 17 12,803,512 (GRCm39) missense possibly damaging 0.79
Z1177:Slc22a2 UTSW 17 12,824,897 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCAACGAAATGCCCACTA -3'
(R):5'- TTCATGGGGAAGGAAGACTTGG -3'

Sequencing Primer
(F):5'- CACGCACGCACACATTTTAAATTG -3'
(R):5'- TGGGGAAGGAAGACTTGGATGAC -3'
Posted On 2021-03-08