Mutagenetix > Incidental Mutation

Incidental Mutation 'R8671:Msh5'

661183

Institutional Source

Beutler Lab

Gene Symbol

Msh5

Ensembl Gene

ENSMUSG00000007035

Gene Name

mutS homolog 5

Synonyms

Mut5, G7

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8671 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

35028605-35046745 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 35045933 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 89 (R89*)

Ref Sequence

ENSEMBL: ENSMUSP00000007250 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000007250] [ENSMUST00000007257] [ENSMUST00000097338] [ENSMUST00000172491] [ENSMUST00000172536] [ENSMUST00000174556] [ENSMUST00000174603]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000007250
AA Change: R89*

SMART Domains

Protein: ENSMUSP00000007250
Gene: ENSMUSG00000007035
AA Change: R89*

Domain	Start	End	E-Value	Type
low complexity region	6	22	N/A	INTRINSIC
low complexity region	33	49	N/A	INTRINSIC
MUTSd	248	568	9.72e-72	SMART
MUTSac	584	775	2.2e-61	SMART
Blast:MUTSac	795	833	3e-11	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000007257

SMART Domains

Protein: ENSMUSP00000007257
Gene: ENSMUSG00000007041

Domain	Start	End	E-Value	Type
Pfam:GST_N_3	21	92	4.8e-11	PFAM
Pfam:GST_N_2	23	87	3.3e-10	PFAM
Pfam:GST_C_2	123	212	3.3e-10	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000097338
AA Change: R89*

SMART Domains

Protein: ENSMUSP00000094951
Gene: ENSMUSG00000007035
AA Change: R89*

Domain	Start	End	E-Value	Type
low complexity region	6	22	N/A	INTRINSIC
low complexity region	33	49	N/A	INTRINSIC
MUTSd	248	568	9.72e-72	SMART
MUTSac	584	775	2.2e-61	SMART
Blast:MUTSac	795	833	3e-11	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000172491

SMART Domains

Protein: ENSMUSP00000133415
Gene: ENSMUSG00000007035

Domain	Start	End	E-Value	Type
low complexity region	6	22	N/A	INTRINSIC
low complexity region	39	48	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000172536
AA Change: R89*

SMART Domains

Protein: ENSMUSP00000134426
Gene: ENSMUSG00000007035
AA Change: R89*

Domain	Start	End	E-Value	Type
low complexity region	6	22	N/A	INTRINSIC
low complexity region	33	49	N/A	INTRINSIC
MUTSd	248	568	9.72e-72	SMART
low complexity region	604	615	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000174556

SMART Domains

Protein: ENSMUSP00000134061
Gene: ENSMUSG00000007035

Domain	Start	End	E-Value	Type
low complexity region	6	22	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000174603
AA Change: R89*

SMART Domains

Protein: ENSMUSP00000134065
Gene: ENSMUSG00000007035
AA Change: R89*

Domain	Start	End	E-Value	Type
low complexity region	6	22	N/A	INTRINSIC
low complexity region	33	49	N/A	INTRINSIC
MUTSd	248	493	1.67e-11	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: This gene encodes a member of the MutS family of proteins that play critical roles in DNA mismatch repair and meiotic homologous recombination processes. Mice lacking the encoded protein are viable but sterile, with severe defects in spermatogenesis in males and complete loss of ovarian structures in females. Mutations in a similar gene in humans have been shown to cause common variable immune deficiency (CVID) and immunoglobulin A deficiency. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit disrupted chromosome pairing in meiosis I resulting in cell death and sterility. In males, testes size is reduced, and in females, there is a total loss of ovarian structure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310002L09Rik	C	T	4: 73,942,929	E145K	probably damaging	Het
4930430A15Rik	T	C	2: 111,229,532		probably benign	Het
4930467E23Rik	T	A	8: 19,734,759	L203*	probably null	Het
Ambp	A	T	4: 63,150,419	Y120*	probably null	Het
Ankrd36	C	T	11: 5,629,312	A192V	probably benign	Het
Apol7e	A	T	15: 77,717,603	M134L	probably benign	Het
Atg9b	A	T	5: 24,386,109	N774K	probably benign	Het
BC027072	G	T	17: 71,751,377	A435E	probably benign	Het
Catsperb	T	A	12: 101,594,337	N862K	possibly damaging	Het
Ccdc7a	T	A	8: 128,920,467	D648V	probably damaging	Het
Cfap54	G	T	10: 92,955,072	P1855T	unknown	Het
Clcnkb	T	A	4: 141,412,230	T154S	probably damaging	Het
Cux1	C	T	5: 136,250,600	R609H	probably damaging	Het
Eif2ak4	A	G	2: 118,422,186	D413G	possibly damaging	Het
Flnc	T	C	6: 29,443,502		probably null	Het
Grm5	T	C	7: 88,116,290		probably null	Het
Hectd3	T	G	4: 116,996,581	F225V	possibly damaging	Het
Hpcal4	G	T	4: 123,189,183	M107I	probably benign	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Ikbkap	A	G	4: 56,771,453	L948P	probably damaging	Het
Larp4	C	A	15: 100,010,458	Q607K	probably benign	Het
March8	A	G	6: 116,401,854	R250G	probably benign	Het
Med13	A	C	11: 86,271,097	N2135K	probably damaging	Het
Musk	T	G	4: 58,286,051		probably benign	Het
Myo18b	T	C	5: 112,874,743	Q261R	unknown	Het
Npr1	A	T	3: 90,456,157		probably benign	Het
Nynrin	T	A	14: 55,870,442	V1002E	possibly damaging	Het
Olfr1138	A	T	2: 87,737,646	L226Q	probably damaging	Het
Olfr1195	A	T	2: 88,683,105	F209Y	probably benign	Het
Olfr1315-ps1	T	A	2: 112,110,988	K88M	probably damaging	Het
Olfr167	T	C	16: 19,515,054	Y194C	possibly damaging	Het
Pcdh9	T	C	14: 93,888,650	Y28C	probably damaging	Het
Pmpca	G	C	2: 26,395,034	E424Q	possibly damaging	Het
Prkd1	T	A	12: 50,388,408	N512I	probably benign	Het
Pwwp2b	C	T	7: 139,256,410	P589L	probably damaging	Het
Rasgrp4	G	A	7: 29,143,027	G242D	probably damaging	Het
Rcbtb1	T	G	14: 59,230,524	V480G	probably damaging	Het
Rptn	A	G	3: 93,398,194	S945G	probably benign	Het
Slc22a2	C	T	17: 12,605,976	Q242*	probably null	Het
Slfn3	T	A	11: 83,212,999	V232E	probably benign	Het
Stab1	T	A	14: 31,157,408	K705M	probably damaging	Het
Syn2	C	A	6: 115,278,167	S480*	probably null	Het
Thsd4	A	T	9: 60,394,445	L189H	probably damaging	Het
Tinagl1	T	C	4: 130,167,804	T250A	probably benign	Het
Tnc	A	T	4: 64,017,446	C418S	probably damaging	Het
Ube2q1	A	G	3: 89,776,078	E110G	probably damaging	Het
Wdfy4	G	T	14: 32,971,765		probably benign	Het
Xcl1	T	C	1: 164,931,850	M94V	probably benign	Het
Zfp369	T	C	13: 65,296,281	S413P	possibly damaging	Het
Zfp454	A	C	11: 50,873,768	I279S	possibly damaging	Het
Zfp971	A	C	2: 178,033,937	Q443P	probably damaging	Het

Other mutations in Msh5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00226:Msh5	APN	17	35029881	nonsense	probably null
IGL00491:Msh5	APN	17	35030730	missense	probably damaging	0.96
IGL01364:Msh5	APN	17	35028769	missense	possibly damaging	0.70
R0189:Msh5	UTSW	17	35029654	missense	probably null	0.97
R0257:Msh5	UTSW	17	35032864	missense	probably damaging	0.99
R0346:Msh5	UTSW	17	35029888	missense	probably benign	0.09
R0449:Msh5	UTSW	17	35041482	missense	probably benign	0.09
R0645:Msh5	UTSW	17	35039223	missense	probably damaging	1.00
R1925:Msh5	UTSW	17	35029952	missense	probably benign	0.00
R1929:Msh5	UTSW	17	35044390	missense	probably benign	0.24
R1970:Msh5	UTSW	17	35033600	missense	probably damaging	0.99
R2025:Msh5	UTSW	17	35032792	missense	possibly damaging	0.90
R2038:Msh5	UTSW	17	35046040	missense	probably benign	0.12
R2058:Msh5	UTSW	17	35029756	missense	probably damaging	0.99
R2271:Msh5	UTSW	17	35044390	missense	probably benign	0.24
R2408:Msh5	UTSW	17	35045119	missense	probably damaging	1.00
R3079:Msh5	UTSW	17	35046232	missense	probably benign	0.41
R4409:Msh5	UTSW	17	35039250	missense	probably damaging	0.98
R4513:Msh5	UTSW	17	35030688	missense	possibly damaging	0.89
R4878:Msh5	UTSW	17	35038456	missense	probably damaging	1.00
R4951:Msh5	UTSW	17	35038420	nonsense	probably null
R5037:Msh5	UTSW	17	35032393	missense	possibly damaging	0.80
R5063:Msh5	UTSW	17	35042188	splice site	probably null
R5064:Msh5	UTSW	17	35043783	intron	probably benign
R5103:Msh5	UTSW	17	35029239	missense	possibly damaging	0.96
R5872:Msh5	UTSW	17	35029652	critical splice donor site	probably null
R6320:Msh5	UTSW	17	35029924	missense	probably damaging	0.97
R6869:Msh5	UTSW	17	35041834	splice site	probably null
R6997:Msh5	UTSW	17	35030002	missense	probably damaging	1.00
R7895:Msh5	UTSW	17	35044379	missense	probably benign	0.04
R8030:Msh5	UTSW	17	35029748	missense	possibly damaging	0.95
R8354:Msh5	UTSW	17	35031766	missense	possibly damaging	0.95
R8384:Msh5	UTSW	17	35030637	missense	probably damaging	1.00
R8804:Msh5	UTSW	17	35032854	missense	probably benign	0.00
R9572:Msh5	UTSW	17	35031393	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGTTTGCCAGGGACAAAATC -3'
(R):5'- TCACGTTGACTAAACTCCCCATG -3'

Sequencing Primer
(F):5'- GCCAGGGACAAAATCTGTAGCATTTC -3'
(R):5'- CATGAGTGCCTATCTCCGAG -3'

Posted On

2021-03-08