Incidental Mutation 'R8671:Pcare'
ID 661184
Institutional Source Beutler Lab
Gene Symbol Pcare
Ensembl Gene ENSMUSG00000044375
Gene Name photoreceptor cilium actin regulator
Synonyms BC027072
MMRRC Submission 068526-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R8671 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 72050919-72059904 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 72058372 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 435 (A435E)
Ref Sequence ENSEMBL: ENSMUSP00000051871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057405]
AlphaFold Q6PAC4
Predicted Effect probably benign
Transcript: ENSMUST00000057405
AA Change: A435E

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000051871
Gene: ENSMUSG00000044375
AA Change: A435E

DomainStartEndE-ValueType
Pfam:Retinal 1 1255 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly expressed in photoreceptors and may associate with the primary cilium of the outer segment. The encoded protein appears to undergo post-translational lipid modification. Nonsense and missense variants of this gene appear to cause a recessive form of retinitis pigmentosa. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele develop severe early-onset retinal degeneration associated with a disorganized outer segment, progressive thinning of the outer nuclear layer, microglia activation, decreased a- and b-wave amplitudes, and nearly undetectable ERG responses by 8 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik C T 4: 73,861,166 (GRCm39) E145K probably damaging Het
Ambp A T 4: 63,068,656 (GRCm39) Y120* probably null Het
Ankrd36 C T 11: 5,579,312 (GRCm39) A192V probably benign Het
Apol7e A T 15: 77,601,803 (GRCm39) M134L probably benign Het
Atg9b A T 5: 24,591,107 (GRCm39) N774K probably benign Het
Catsperb T A 12: 101,560,596 (GRCm39) N862K possibly damaging Het
Ccdc7a T A 8: 129,646,948 (GRCm39) D648V probably damaging Het
Cfap54 G T 10: 92,790,934 (GRCm39) P1855T unknown Het
Clcnkb T A 4: 141,139,541 (GRCm39) T154S probably damaging Het
Cux1 C T 5: 136,279,454 (GRCm39) R609H probably damaging Het
Eif2ak4 A G 2: 118,252,667 (GRCm39) D413G possibly damaging Het
Elp1 A G 4: 56,771,453 (GRCm39) L948P probably damaging Het
Flnc T C 6: 29,443,501 (GRCm39) probably null Het
Grm5 T C 7: 87,765,498 (GRCm39) probably null Het
Hectd3 T G 4: 116,853,778 (GRCm39) F225V possibly damaging Het
Hpcal4 G T 4: 123,082,976 (GRCm39) M107I probably benign Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Larp4 C A 15: 99,908,339 (GRCm39) Q607K probably benign Het
Marchf8 A G 6: 116,378,815 (GRCm39) R250G probably benign Het
Med13 A C 11: 86,161,923 (GRCm39) N2135K probably damaging Het
Msh5 T A 17: 35,264,909 (GRCm39) R89* probably null Het
Musk T G 4: 58,286,051 (GRCm39) probably benign Het
Myo18b T C 5: 113,022,609 (GRCm39) Q261R unknown Het
Npr1 A T 3: 90,363,464 (GRCm39) probably benign Het
Nynrin T A 14: 56,107,899 (GRCm39) V1002E possibly damaging Het
Or2l5 T C 16: 19,333,804 (GRCm39) Y194C possibly damaging Het
Or4c103 A T 2: 88,513,449 (GRCm39) F209Y probably benign Het
Or4f14c T A 2: 111,941,333 (GRCm39) K88M probably damaging Het
Or5w15 A T 2: 87,567,990 (GRCm39) L226Q probably damaging Het
Pcdh9 T C 14: 94,126,086 (GRCm39) Y28C probably damaging Het
Pmpca G C 2: 26,285,046 (GRCm39) E424Q possibly damaging Het
Potefam1 T C 2: 111,059,877 (GRCm39) probably benign Het
Potefam3e T A 8: 19,784,775 (GRCm39) L203* probably null Het
Prkd1 T A 12: 50,435,191 (GRCm39) N512I probably benign Het
Pwwp2b C T 7: 138,836,326 (GRCm39) P589L probably damaging Het
Rasgrp4 G A 7: 28,842,452 (GRCm39) G242D probably damaging Het
Rcbtb1 T G 14: 59,467,973 (GRCm39) V480G probably damaging Het
Rptn A G 3: 93,305,501 (GRCm39) S945G probably benign Het
Slc22a2 C T 17: 12,824,863 (GRCm39) Q242* probably null Het
Slfn3 T A 11: 83,103,825 (GRCm39) V232E probably benign Het
Stab1 T A 14: 30,879,365 (GRCm39) K705M probably damaging Het
Syn2 C A 6: 115,255,128 (GRCm39) S480* probably null Het
Thsd4 A T 9: 60,301,728 (GRCm39) L189H probably damaging Het
Tinagl1 T C 4: 130,061,597 (GRCm39) T250A probably benign Het
Tnc A T 4: 63,935,683 (GRCm39) C418S probably damaging Het
Ube2q1 A G 3: 89,683,385 (GRCm39) E110G probably damaging Het
Wdfy4 G T 14: 32,693,722 (GRCm39) probably benign Het
Xcl1 T C 1: 164,759,419 (GRCm39) M94V probably benign Het
Zfp369 T C 13: 65,444,095 (GRCm39) S413P possibly damaging Het
Zfp454 A C 11: 50,764,595 (GRCm39) I279S possibly damaging Het
Zfp971 A C 2: 177,675,730 (GRCm39) Q443P probably damaging Het
Other mutations in Pcare
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02010:Pcare APN 17 72,056,459 (GRCm39) missense probably benign 0.38
IGL02033:Pcare APN 17 72,058,076 (GRCm39) missense probably damaging 1.00
IGL02711:Pcare APN 17 72,056,377 (GRCm39) missense probably benign 0.15
IGL03185:Pcare APN 17 72,056,332 (GRCm39) missense probably damaging 0.98
IGL03242:Pcare APN 17 72,057,266 (GRCm39) missense probably benign 0.01
R0367:Pcare UTSW 17 72,057,471 (GRCm39) missense probably damaging 1.00
R0413:Pcare UTSW 17 72,059,212 (GRCm39) missense probably benign 0.38
R0465:Pcare UTSW 17 72,057,155 (GRCm39) missense probably benign 0.42
R0535:Pcare UTSW 17 72,059,434 (GRCm39) missense probably benign 0.01
R0681:Pcare UTSW 17 72,056,509 (GRCm39) missense probably benign 0.00
R0736:Pcare UTSW 17 72,051,659 (GRCm39) missense probably benign 0.00
R1406:Pcare UTSW 17 72,056,156 (GRCm39) missense probably benign 0.18
R1406:Pcare UTSW 17 72,056,156 (GRCm39) missense probably benign 0.18
R1530:Pcare UTSW 17 72,056,473 (GRCm39) missense probably benign 0.01
R1723:Pcare UTSW 17 72,057,373 (GRCm39) missense probably damaging 1.00
R1941:Pcare UTSW 17 72,059,063 (GRCm39) missense probably damaging 1.00
R2179:Pcare UTSW 17 72,059,521 (GRCm39) missense probably damaging 1.00
R2232:Pcare UTSW 17 72,056,279 (GRCm39) missense probably benign 0.00
R2519:Pcare UTSW 17 72,058,642 (GRCm39) missense probably damaging 1.00
R2997:Pcare UTSW 17 72,051,706 (GRCm39) critical splice acceptor site probably benign
R3899:Pcare UTSW 17 72,057,155 (GRCm39) missense probably benign 0.00
R4890:Pcare UTSW 17 72,059,306 (GRCm39) missense possibly damaging 0.50
R4898:Pcare UTSW 17 72,058,066 (GRCm39) missense probably damaging 1.00
R5347:Pcare UTSW 17 72,056,930 (GRCm39) missense probably benign 0.00
R5436:Pcare UTSW 17 72,057,837 (GRCm39) missense probably damaging 1.00
R5527:Pcare UTSW 17 72,059,635 (GRCm39) missense probably damaging 1.00
R5556:Pcare UTSW 17 72,059,420 (GRCm39) missense possibly damaging 0.81
R5625:Pcare UTSW 17 72,058,321 (GRCm39) missense probably damaging 1.00
R5707:Pcare UTSW 17 72,058,567 (GRCm39) missense possibly damaging 0.90
R5932:Pcare UTSW 17 72,058,748 (GRCm39) missense probably damaging 1.00
R6043:Pcare UTSW 17 72,057,037 (GRCm39) missense probably damaging 1.00
R6314:Pcare UTSW 17 72,059,452 (GRCm39) missense probably benign 0.04
R6513:Pcare UTSW 17 72,051,701 (GRCm39) missense probably damaging 1.00
R7575:Pcare UTSW 17 72,057,850 (GRCm39) missense probably damaging 1.00
R7638:Pcare UTSW 17 72,057,880 (GRCm39) missense probably damaging 1.00
R7848:Pcare UTSW 17 72,056,188 (GRCm39) missense probably benign 0.04
R8317:Pcare UTSW 17 72,056,197 (GRCm39) missense probably benign 0.10
R8530:Pcare UTSW 17 72,059,101 (GRCm39) missense probably damaging 1.00
R8831:Pcare UTSW 17 72,059,305 (GRCm39) missense probably benign 0.01
R8854:Pcare UTSW 17 72,056,326 (GRCm39) missense probably benign
R8941:Pcare UTSW 17 72,059,137 (GRCm39) missense probably benign 0.06
R9227:Pcare UTSW 17 72,057,217 (GRCm39) missense probably damaging 1.00
R9230:Pcare UTSW 17 72,057,217 (GRCm39) missense probably damaging 1.00
R9380:Pcare UTSW 17 72,056,351 (GRCm39) missense possibly damaging 0.95
R9390:Pcare UTSW 17 72,057,983 (GRCm39) missense probably benign 0.09
R9618:Pcare UTSW 17 72,057,817 (GRCm39) missense probably damaging 1.00
X0035:Pcare UTSW 17 72,051,706 (GRCm39) critical splice acceptor site probably benign
Z1177:Pcare UTSW 17 72,057,398 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCGTGGTCTTGAAGGTAGG -3'
(R):5'- CTTTGCAGCAGAACTTGGAG -3'

Sequencing Primer
(F):5'- CAGGTCGGTGCTGCTAAG -3'
(R):5'- CTTTGCAGCAGAACTTGGAGAATGG -3'
Posted On 2021-03-08