Incidental Mutation 'R8672:Cd46'
ID661188
Institutional Source Beutler Lab
Gene Symbol Cd46
Ensembl Gene ENSMUSG00000016493
Gene NameCD46 antigen, complement regulatory protein
SynonymsCD46, Mcp
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8672 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location195036826-195092249 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 195082641 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 216 (T216I)
Ref Sequence ENSEMBL: ENSMUSP00000123931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159563] [ENSMUST00000162650]
Predicted Effect probably benign
Transcript: ENSMUST00000159563
AA Change: T216I

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000123901
Gene: ENSMUSG00000016493
AA Change: T216I

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
CCP 45 104 6.7e-3 SMART
CCP 109 168 3.87e-8 SMART
CCP 173 234 2.14e-10 SMART
CCP 239 294 1.06e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162650
AA Change: T216I

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000123931
Gene: ENSMUSG00000016493
AA Change: T216I

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
CCP 45 104 6.7e-3 SMART
CCP 109 168 3.87e-8 SMART
CCP 173 234 2.14e-10 SMART
CCP 239 294 1.06e-14 SMART
transmembrane domain 328 350 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I membrane protein and is a regulatory part of the complement system. The encoded protein has cofactor activity for inactivation of complement components C3b and C4b by serum factor I, which protects the host cell from damage by complement. In addition, the encoded protein can act as a receptor for the Edmonston strain of measles virus, human herpesvirus-6, and type IV pili of pathogenic Neisseria. Finally, the protein encoded by this gene may be involved in the fusion of the spermatozoa with the oocyte during fertilization. Mutations at this locus have been associated with susceptibility to hemolytic uremic syndrome. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygous mutation of this gene results in increased litter sizes sired by mutant males. Another homozygous null mouse shows increased susceptibility to induced choroid neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik G T 17: 48,090,329 E45* probably null Het
4932415D10Rik A T 10: 82,291,892 N1761K probably benign Het
9930021J03Rik T C 19: 29,754,164 T483A probably benign Het
Aadat A T 8: 60,506,145 probably benign Het
Amigo3 A G 9: 108,054,176 H266R possibly damaging Het
Amy2a1 A T 3: 113,529,497 M214K probably damaging Het
Atp11b A T 3: 35,819,917 D685V probably benign Het
Aunip T A 4: 134,523,149 M135K probably benign Het
Card9 T C 2: 26,357,938 T134A probably benign Het
Chit1 T C 1: 134,151,267 V360A unknown Het
Crcp A G 5: 130,042,236 R59G probably benign Het
Csmd1 T A 8: 15,926,598 E2873D probably benign Het
Cyp8b1 T A 9: 121,914,920 M449L probably benign Het
Dpp7 T C 2: 25,356,121 D40G probably benign Het
Eif4g3 T A 4: 138,126,512 L463Q possibly damaging Het
Fzd9 T C 5: 135,249,670 I454V probably benign Het
Gbp11 T A 5: 105,343,809 I41F probably damaging Het
Gkap1 G A 13: 58,243,848 T231I probably damaging Het
Heatr5b A G 17: 78,762,203 L1705P probably damaging Het
Herc3 T A 6: 58,873,801 F467I probably damaging Het
Ifih1 T C 2: 62,605,649 E699G possibly damaging Het
Ints5 T A 19: 8,896,006 L443Q probably damaging Het
Itpr2 A T 6: 146,374,518 C764S probably damaging Het
Kcnma1 A T 14: 23,501,162 I519N probably damaging Het
Krtap4-1 C T 11: 99,628,064 C40Y unknown Het
Mdn1 A G 4: 32,768,793 D5384G probably damaging Het
Mpl T C 4: 118,448,913 Y310C probably damaging Het
Mucl1 A G 15: 103,753,797 S48P possibly damaging Het
Musk T G 4: 58,286,051 probably benign Het
Nemp1 T C 10: 127,677,119 S8P probably benign Het
Nisch A G 14: 31,173,136 C1068R probably damaging Het
Npr3 T C 15: 11,851,493 N404D probably damaging Het
Nwd1 C G 8: 72,667,379 H423Q probably damaging Het
Olfr1062 T A 2: 86,423,632 M15L probably benign Het
Olfr76 C T 19: 12,120,557 V52M probably benign Het
Olfr792 T A 10: 129,540,727 N63K probably damaging Het
Pcdh9 T C 14: 93,887,093 N547S probably benign Het
Pdha2 C A 3: 141,211,363 R128L probably damaging Het
Pebp1 A G 5: 117,283,271 Y181H probably benign Het
Peg3 T G 7: 6,708,524 D1233A possibly damaging Het
Pepd C A 7: 34,942,682 T146N probably damaging Het
Ptk2b A T 14: 66,156,392 D877E probably benign Het
Rabgap1l A C 1: 160,443,276 M647R probably damaging Het
Rp1 A G 1: 4,348,784 S702P possibly damaging Het
Shb A T 4: 45,489,161 D238E probably damaging Het
Slc36a1 T A 11: 55,232,508 V433D possibly damaging Het
Spen C T 4: 141,470,370 A3396T probably benign Het
Tcerg1 A T 18: 42,553,494 K705N probably damaging Het
Thbs1 C A 2: 118,113,238 N112K probably benign Het
Zfp658 T C 7: 43,573,495 I398T possibly damaging Het
Other mutations in Cd46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02429:Cd46 APN 1 195085424 missense probably benign 0.01
IGL03029:Cd46 APN 1 195086143 missense probably benign 0.43
R0269:Cd46 UTSW 1 195064688 missense probably benign 0.00
R0375:Cd46 UTSW 1 195086164 missense probably benign 0.00
R0627:Cd46 UTSW 1 195092186 missense probably benign 0.03
R0784:Cd46 UTSW 1 195092194 missense possibly damaging 0.96
R0892:Cd46 UTSW 1 195082612 missense possibly damaging 0.78
R0973:Cd46 UTSW 1 195041992 makesense probably null
R0973:Cd46 UTSW 1 195041992 makesense probably null
R0974:Cd46 UTSW 1 195041992 makesense probably null
R1224:Cd46 UTSW 1 195062398 missense possibly damaging 0.66
R1716:Cd46 UTSW 1 195077809 missense probably benign 0.21
R1863:Cd46 UTSW 1 195083623 missense probably damaging 1.00
R2000:Cd46 UTSW 1 195077704 missense probably benign 0.00
R2152:Cd46 UTSW 1 195062413 missense probably benign 0.42
R2153:Cd46 UTSW 1 195062413 missense probably benign 0.42
R4452:Cd46 UTSW 1 195085360 missense possibly damaging 0.84
R4860:Cd46 UTSW 1 195062396 missense possibly damaging 0.94
R4860:Cd46 UTSW 1 195062396 missense possibly damaging 0.94
R4934:Cd46 UTSW 1 195082799 intron probably benign
R5156:Cd46 UTSW 1 195085385 missense possibly damaging 0.90
R5287:Cd46 UTSW 1 195062411 missense possibly damaging 0.65
R5303:Cd46 UTSW 1 195062399 missense probably benign
R5403:Cd46 UTSW 1 195062411 missense possibly damaging 0.65
R5487:Cd46 UTSW 1 195068170 critical splice acceptor site probably null
R5505:Cd46 UTSW 1 195085380 missense possibly damaging 0.88
R5538:Cd46 UTSW 1 195068170 critical splice acceptor site probably null
R6721:Cd46 UTSW 1 195083631 missense probably damaging 1.00
R6731:Cd46 UTSW 1 195083467 splice site probably null
R7226:Cd46 UTSW 1 195042006 missense possibly damaging 0.84
R7633:Cd46 UTSW 1 195083619 missense probably null 0.01
R8277:Cd46 UTSW 1 195064722 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGGTAGTAGCTCACATACCAGG -3'
(R):5'- TGTCCTAAAAGGTCATTTCTTAGGGG -3'

Sequencing Primer
(F):5'- TAGTAGCTCACATACCAGGAAATG -3'
(R):5'- AAGGTCATTTCTTAGGGGTTTAAAC -3'
Posted On2021-03-08