Incidental Mutation 'R8672:Dpp7'
ID661189
Institutional Source Beutler Lab
Gene Symbol Dpp7
Ensembl Gene ENSMUSG00000026958
Gene Namedipeptidylpeptidase 7
SynonymsQPP
Accession Numbers

Genbank: NM_031843.2; Ensembl: ENSMUST00000028332

Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R8672 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location25352276-25356359 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25356121 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 40 (D40G)
Ref Sequence ENSEMBL: ENSMUSP00000028332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028332] [ENSMUST00000042390] [ENSMUST00000102925]
Predicted Effect probably benign
Transcript: ENSMUST00000028332
AA Change: D40G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000028332
Gene: ENSMUSG00000026958
AA Change: D40G

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Peptidase_S28 48 475 2.3e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042390
SMART Domains Protein: ENSMUSP00000036996
Gene: ENSMUSG00000036646

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 29 42 N/A INTRINSIC
transmembrane domain 49 71 N/A INTRINSIC
Pfam:Glyco_hydro_47 215 654 9.5e-167 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102925
SMART Domains Protein: ENSMUSP00000099989
Gene: ENSMUSG00000026956

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
Pfam:UDPGP 68 453 2.1e-63 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a post-proline cleaving aminopeptidase expressed in quiescent lymphocytes. The resting lymphocytes are maintained through suppression of apoptosis, a state which is disrupted by inhibition of this novel serine protease. The enzyme has strong sequence homology with prolylcarboxypeptidase and is active at both acidic and neutral pH. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik G T 17: 48,090,329 E45* probably null Het
4932415D10Rik A T 10: 82,291,892 N1761K probably benign Het
9930021J03Rik T C 19: 29,754,164 T483A probably benign Het
Aadat A T 8: 60,506,145 probably benign Het
Amigo3 A G 9: 108,054,176 H266R possibly damaging Het
Amy2a1 A T 3: 113,529,497 M214K probably damaging Het
Atp11b A T 3: 35,819,917 D685V probably benign Het
Aunip T A 4: 134,523,149 M135K probably benign Het
Card9 T C 2: 26,357,938 T134A probably benign Het
Cd46 G A 1: 195,082,641 T216I probably benign Het
Chit1 T C 1: 134,151,267 V360A unknown Het
Crcp A G 5: 130,042,236 R59G probably benign Het
Csmd1 T A 8: 15,926,598 E2873D probably benign Het
Cyp8b1 T A 9: 121,914,920 M449L probably benign Het
Eif4g3 T A 4: 138,126,512 L463Q possibly damaging Het
Fzd9 T C 5: 135,249,670 I454V probably benign Het
Gbp11 T A 5: 105,343,809 I41F probably damaging Het
Gkap1 G A 13: 58,243,848 T231I probably damaging Het
Heatr5b A G 17: 78,762,203 L1705P probably damaging Het
Herc3 T A 6: 58,873,801 F467I probably damaging Het
Ifih1 T C 2: 62,605,649 E699G possibly damaging Het
Ints5 T A 19: 8,896,006 L443Q probably damaging Het
Itpr2 A T 6: 146,374,518 C764S probably damaging Het
Kcnma1 A T 14: 23,501,162 I519N probably damaging Het
Krtap4-1 C T 11: 99,628,064 C40Y unknown Het
Mdn1 A G 4: 32,768,793 D5384G probably damaging Het
Mpl T C 4: 118,448,913 Y310C probably damaging Het
Mucl1 A G 15: 103,753,797 S48P possibly damaging Het
Musk T G 4: 58,286,051 probably benign Het
Nemp1 T C 10: 127,677,119 S8P probably benign Het
Nisch A G 14: 31,173,136 C1068R probably damaging Het
Npr3 T C 15: 11,851,493 N404D probably damaging Het
Nwd1 C G 8: 72,667,379 H423Q probably damaging Het
Olfr1062 T A 2: 86,423,632 M15L probably benign Het
Olfr76 C T 19: 12,120,557 V52M probably benign Het
Olfr792 T A 10: 129,540,727 N63K probably damaging Het
Pcdh9 T C 14: 93,887,093 N547S probably benign Het
Pdha2 C A 3: 141,211,363 R128L probably damaging Het
Pebp1 A G 5: 117,283,271 Y181H probably benign Het
Peg3 T G 7: 6,708,524 D1233A possibly damaging Het
Pepd C A 7: 34,942,682 T146N probably damaging Het
Ptk2b A T 14: 66,156,392 D877E probably benign Het
Rabgap1l A C 1: 160,443,276 M647R probably damaging Het
Rp1 A G 1: 4,348,784 S702P possibly damaging Het
Shb A T 4: 45,489,161 D238E probably damaging Het
Slc36a1 T A 11: 55,232,508 V433D possibly damaging Het
Spen C T 4: 141,470,370 A3396T probably benign Het
Tcerg1 A T 18: 42,553,494 K705N probably damaging Het
Thbs1 C A 2: 118,113,238 N112K probably benign Het
Zfp658 T C 7: 43,573,495 I398T possibly damaging Het
Other mutations in Dpp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Dpp7 APN 2 25354613 missense probably benign 0.01
IGL02897:Dpp7 APN 2 25353672 missense probably damaging 1.00
IGL02992:Dpp7 APN 2 25354577 missense possibly damaging 0.65
IGL03069:Dpp7 APN 2 25355723 critical splice acceptor site probably null
1mM(1):Dpp7 UTSW 2 25356140 missense probably benign 0.05
PIT4519001:Dpp7 UTSW 2 25352448 missense probably damaging 0.97
R0051:Dpp7 UTSW 2 25356095 missense possibly damaging 0.80
R0051:Dpp7 UTSW 2 25356095 missense possibly damaging 0.80
R0900:Dpp7 UTSW 2 25356299 missense probably damaging 0.99
R1889:Dpp7 UTSW 2 25353679 splice site probably null
R1895:Dpp7 UTSW 2 25353679 splice site probably null
R2055:Dpp7 UTSW 2 25354478 missense possibly damaging 0.84
R4697:Dpp7 UTSW 2 25354919 missense probably benign 0.00
R4832:Dpp7 UTSW 2 25352386 unclassified probably benign
R4887:Dpp7 UTSW 2 25352758 critical splice acceptor site probably null
R5114:Dpp7 UTSW 2 25352737 missense possibly damaging 0.51
R6976:Dpp7 UTSW 2 25354824 critical splice acceptor site probably null
R7577:Dpp7 UTSW 2 25355591 missense probably benign
R8459:Dpp7 UTSW 2 25352538 missense probably damaging 1.00
R8486:Dpp7 UTSW 2 25352549 missense probably damaging 1.00
R8690:Dpp7 UTSW 2 25355633 missense probably damaging 1.00
X0058:Dpp7 UTSW 2 25354752 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGCGAAGGACCAGATATCCC -3'
(R):5'- TGTTACCCTGTGGACCATGG -3'

Sequencing Primer
(F):5'- AAAAGATGGGCCCTTCGC -3'
(R):5'- TGTGGACCATGGTGTCCC -3'
Posted On2021-03-08