Incidental Mutation 'R8672:Card9'
ID661190
Institutional Source Beutler Lab
Gene Symbol Card9
Ensembl Gene ENSMUSG00000026928
Gene Namecaspase recruitment domain family, member 9
SynonymsLOC332579
Accession Numbers

Ncbi RefSeq: NM_001037747; MGI:2685628

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8672 (G1)
Quality Score195.009
Status Not validated
Chromosome2
Chromosomal Location26352176-26360918 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26357938 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 134 (T134A)
Ref Sequence ENSEMBL: ENSMUSP00000097876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028294] [ENSMUST00000035427] [ENSMUST00000100303] [ENSMUST00000114115]
Predicted Effect probably benign
Transcript: ENSMUST00000028294
AA Change: T134A

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000028294
Gene: ENSMUSG00000026928
AA Change: T134A

DomainStartEndE-ValueType
Pfam:CARD 11 97 3.1e-21 PFAM
coiled coil region 145 272 N/A INTRINSIC
coiled coil region 375 415 N/A INTRINSIC
low complexity region 482 494 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035427
SMART Domains Protein: ENSMUSP00000041767
Gene: ENSMUSG00000036281

DomainStartEndE-ValueType
low complexity region 33 52 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
coiled coil region 93 119 N/A INTRINSIC
low complexity region 200 212 N/A INTRINSIC
SANT 219 290 2.37e1 SMART
SANT 293 343 4.38e-10 SMART
SANT 345 397 3.05e-9 SMART
SANT 400 449 8.24e-15 SMART
SANT 452 501 7.8e-16 SMART
low complexity region 516 547 N/A INTRINSIC
Blast:SANT 550 753 1e-23 BLAST
low complexity region 893 909 N/A INTRINSIC
low complexity region 925 947 N/A INTRINSIC
low complexity region 971 983 N/A INTRINSIC
low complexity region 988 1007 N/A INTRINSIC
low complexity region 1157 1169 N/A INTRINSIC
low complexity region 1176 1190 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100303
AA Change: T134A

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097876
Gene: ENSMUSG00000026928
AA Change: T134A

DomainStartEndE-ValueType
Pfam:CARD 11 97 7.1e-22 PFAM
coiled coil region 145 272 N/A INTRINSIC
coiled coil region 375 415 N/A INTRINSIC
low complexity region 482 494 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114115
SMART Domains Protein: ENSMUSP00000109750
Gene: ENSMUSG00000036281

DomainStartEndE-ValueType
coiled coil region 3 29 N/A INTRINSIC
low complexity region 41 60 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
coiled coil region 101 127 N/A INTRINSIC
low complexity region 208 220 N/A INTRINSIC
SANT 227 298 2.37e1 SMART
SANT 301 351 4.38e-10 SMART
SANT 353 405 3.05e-9 SMART
SANT 408 457 8.24e-15 SMART
SANT 460 509 7.8e-16 SMART
low complexity region 524 555 N/A INTRINSIC
Blast:SANT 558 761 1e-23 BLAST
low complexity region 901 917 N/A INTRINSIC
low complexity region 933 955 N/A INTRINSIC
low complexity region 979 991 N/A INTRINSIC
low complexity region 996 1015 N/A INTRINSIC
low complexity region 1165 1177 N/A INTRINSIC
low complexity region 1184 1198 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the CARD protein family, which is defined by the presence of a characteristic caspase-associated recruitment domain (CARD). CARD is a protein interaction domain known to participate in activation or suppression of CARD containing members of the caspase family, and thus plays an important regulatory role in cell apoptosis. This protein was identified by its selective association with the CARD domain of BCL10, a postive regulator of apoptosis and NF-kappaB activation, and is thought to function as a molecular scaffold for the assembly of a BCL10 signaling complex that activates NF-kappaB. Several alternatively spliced transcript variants have been observed, but their full-length nature is not clearly defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one allele of this gene display impaired immune responses to fungal infection but normal rates of bacterial clearance. However, homozygotes for a second allele display impaired bacterial clearance and impaired early innate immune responses. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(5) Gene trapped(1)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik G T 17: 48,090,329 E45* probably null Het
4932415D10Rik A T 10: 82,291,892 N1761K probably benign Het
9930021J03Rik T C 19: 29,754,164 T483A probably benign Het
Aadat A T 8: 60,506,145 probably benign Het
Amigo3 A G 9: 108,054,176 H266R possibly damaging Het
Amy2a1 A T 3: 113,529,497 M214K probably damaging Het
Atp11b A T 3: 35,819,917 D685V probably benign Het
Aunip T A 4: 134,523,149 M135K probably benign Het
Cd46 G A 1: 195,082,641 T216I probably benign Het
Chit1 T C 1: 134,151,267 V360A unknown Het
Crcp A G 5: 130,042,236 R59G probably benign Het
Csmd1 T A 8: 15,926,598 E2873D probably benign Het
Cyp8b1 T A 9: 121,914,920 M449L probably benign Het
Dpp7 T C 2: 25,356,121 D40G probably benign Het
Eif4g3 T A 4: 138,126,512 L463Q possibly damaging Het
Fzd9 T C 5: 135,249,670 I454V probably benign Het
Gbp11 T A 5: 105,343,809 I41F probably damaging Het
Gkap1 G A 13: 58,243,848 T231I probably damaging Het
Heatr5b A G 17: 78,762,203 L1705P probably damaging Het
Herc3 T A 6: 58,873,801 F467I probably damaging Het
Ifih1 T C 2: 62,605,649 E699G possibly damaging Het
Ints5 T A 19: 8,896,006 L443Q probably damaging Het
Itpr2 A T 6: 146,374,518 C764S probably damaging Het
Kcnma1 A T 14: 23,501,162 I519N probably damaging Het
Krtap4-1 C T 11: 99,628,064 C40Y unknown Het
Mdn1 A G 4: 32,768,793 D5384G probably damaging Het
Mpl T C 4: 118,448,913 Y310C probably damaging Het
Mucl1 A G 15: 103,753,797 S48P possibly damaging Het
Musk T G 4: 58,286,051 probably benign Het
Nemp1 T C 10: 127,677,119 S8P probably benign Het
Nisch A G 14: 31,173,136 C1068R probably damaging Het
Npr3 T C 15: 11,851,493 N404D probably damaging Het
Nwd1 C G 8: 72,667,379 H423Q probably damaging Het
Olfr1062 T A 2: 86,423,632 M15L probably benign Het
Olfr76 C T 19: 12,120,557 V52M probably benign Het
Olfr792 T A 10: 129,540,727 N63K probably damaging Het
Pcdh9 T C 14: 93,887,093 N547S probably benign Het
Pdha2 C A 3: 141,211,363 R128L probably damaging Het
Pebp1 A G 5: 117,283,271 Y181H probably benign Het
Peg3 T G 7: 6,708,524 D1233A possibly damaging Het
Pepd C A 7: 34,942,682 T146N probably damaging Het
Ptk2b A T 14: 66,156,392 D877E probably benign Het
Rabgap1l A C 1: 160,443,276 M647R probably damaging Het
Rp1 A G 1: 4,348,784 S702P possibly damaging Het
Shb A T 4: 45,489,161 D238E probably damaging Het
Slc36a1 T A 11: 55,232,508 V433D possibly damaging Het
Spen C T 4: 141,470,370 A3396T probably benign Het
Tcerg1 A T 18: 42,553,494 K705N probably damaging Het
Thbs1 C A 2: 118,113,238 N112K probably benign Het
Zfp658 T C 7: 43,573,495 I398T possibly damaging Het
Other mutations in Card9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01704:Card9 APN 2 26356862 missense probably benign
IGL02397:Card9 APN 2 26352329 missense probably damaging 1.00
IGL02506:Card9 APN 2 26354415 splice site probably benign
IGL02536:Card9 APN 2 26358832 missense possibly damaging 0.93
IGL02809:Card9 APN 2 26356864 missense probably benign 0.01
IGL02962:Card9 APN 2 26358017 critical splice acceptor site probably null
R1441:Card9 UTSW 2 26359390 missense probably benign 0.01
R1585:Card9 UTSW 2 26354386 missense probably benign 0.01
R1755:Card9 UTSW 2 26359534 missense probably damaging 0.99
R1959:Card9 UTSW 2 26354873 critical splice acceptor site probably null
R2972:Card9 UTSW 2 26357210 missense probably damaging 1.00
R4007:Card9 UTSW 2 26353000 missense possibly damaging 0.95
R4283:Card9 UTSW 2 26357297 missense possibly damaging 0.77
R4789:Card9 UTSW 2 26357620 missense probably damaging 0.99
R5381:Card9 UTSW 2 26358883 missense probably damaging 1.00
R5933:Card9 UTSW 2 26352497 missense probably damaging 1.00
R6379:Card9 UTSW 2 26356777 missense probably damaging 1.00
R7008:Card9 UTSW 2 26357799 missense possibly damaging 0.96
R7124:Card9 UTSW 2 26356884 critical splice acceptor site probably null
R7131:Card9 UTSW 2 26358835 missense probably damaging 1.00
R7171:Card9 UTSW 2 26359484 missense possibly damaging 0.78
R7237:Card9 UTSW 2 26356775 missense probably benign 0.00
R7984:Card9 UTSW 2 26356772 missense probably benign 0.00
R8023:Card9 UTSW 2 26357315 missense probably benign 0.00
R8312:Card9 UTSW 2 26357789 nonsense probably null
Z1176:Card9 UTSW 2 26357796 missense probably damaging 1.00
Z1177:Card9 UTSW 2 26357551 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCACTCAGATGTGCCAGGC -3'
(R):5'- GAGAGACCCATCCTACCAGTTTTC -3'

Sequencing Primer
(F):5'- GCACATGGCCAGCTCATAGTTC -3'
(R):5'- ATCCTACCAGTTTTCTCTGTGGGAG -3'
Posted On2021-03-08