Incidental Mutation 'R8672:Gbp11'
ID661204
Institutional Source Beutler Lab
Gene Symbol Gbp11
Ensembl Gene ENSMUSG00000092021
Gene Nameguanylate binding protein 11
SynonymsGm7141
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R8672 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location105323042-105346472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105343809 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 41 (I41F)
Ref Sequence ENSEMBL: ENSMUSP00000132552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100960] [ENSMUST00000171587]
Predicted Effect probably damaging
Transcript: ENSMUST00000100960
AA Change: I41F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098520
Gene: ENSMUSG00000092021
AA Change: I41F

DomainStartEndE-ValueType
Pfam:GBP 16 279 1.5e-122 PFAM
Pfam:GBP_C 281 574 3.4e-114 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171587
AA Change: I41F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132552
Gene: ENSMUSG00000092021
AA Change: I41F

DomainStartEndE-ValueType
Pfam:GBP 16 279 4.9e-117 PFAM
Pfam:GBP_C 281 442 2.7e-75 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik G T 17: 48,090,329 E45* probably null Het
4932415D10Rik A T 10: 82,291,892 N1761K probably benign Het
9930021J03Rik T C 19: 29,754,164 T483A probably benign Het
Aadat A T 8: 60,506,145 probably benign Het
Amigo3 A G 9: 108,054,176 H266R possibly damaging Het
Amy2a1 A T 3: 113,529,497 M214K probably damaging Het
Atp11b A T 3: 35,819,917 D685V probably benign Het
Aunip T A 4: 134,523,149 M135K probably benign Het
Card9 T C 2: 26,357,938 T134A probably benign Het
Cd46 G A 1: 195,082,641 T216I probably benign Het
Chit1 T C 1: 134,151,267 V360A unknown Het
Crcp A G 5: 130,042,236 R59G probably benign Het
Csmd1 T A 8: 15,926,598 E2873D probably benign Het
Cyp8b1 T A 9: 121,914,920 M449L probably benign Het
Dpp7 T C 2: 25,356,121 D40G probably benign Het
Eif4g3 T A 4: 138,126,512 L463Q possibly damaging Het
Fzd9 T C 5: 135,249,670 I454V probably benign Het
Gkap1 G A 13: 58,243,848 T231I probably damaging Het
Heatr5b A G 17: 78,762,203 L1705P probably damaging Het
Herc3 T A 6: 58,873,801 F467I probably damaging Het
Ifih1 T C 2: 62,605,649 E699G possibly damaging Het
Ints5 T A 19: 8,896,006 L443Q probably damaging Het
Itpr2 A T 6: 146,374,518 C764S probably damaging Het
Kcnma1 A T 14: 23,501,162 I519N probably damaging Het
Krtap4-1 C T 11: 99,628,064 C40Y unknown Het
Mdn1 A G 4: 32,768,793 D5384G probably damaging Het
Mpl T C 4: 118,448,913 Y310C probably damaging Het
Mucl1 A G 15: 103,753,797 S48P possibly damaging Het
Musk T G 4: 58,286,051 probably benign Het
Nemp1 T C 10: 127,677,119 S8P probably benign Het
Nisch A G 14: 31,173,136 C1068R probably damaging Het
Npr3 T C 15: 11,851,493 N404D probably damaging Het
Nwd1 C G 8: 72,667,379 H423Q probably damaging Het
Olfr1062 T A 2: 86,423,632 M15L probably benign Het
Olfr76 C T 19: 12,120,557 V52M probably benign Het
Olfr792 T A 10: 129,540,727 N63K probably damaging Het
Pcdh9 T C 14: 93,887,093 N547S probably benign Het
Pdha2 C A 3: 141,211,363 R128L probably damaging Het
Pebp1 A G 5: 117,283,271 Y181H probably benign Het
Peg3 T G 7: 6,708,524 D1233A possibly damaging Het
Pepd C A 7: 34,942,682 T146N probably damaging Het
Ptk2b A T 14: 66,156,392 D877E probably benign Het
Rabgap1l A C 1: 160,443,276 M647R probably damaging Het
Rp1 A G 1: 4,348,784 S702P possibly damaging Het
Shb A T 4: 45,489,161 D238E probably damaging Het
Slc36a1 T A 11: 55,232,508 V433D possibly damaging Het
Spen C T 4: 141,470,370 A3396T probably benign Het
Tcerg1 A T 18: 42,553,494 K705N probably damaging Het
Thbs1 C A 2: 118,113,238 N112K probably benign Het
Zfp658 T C 7: 43,573,495 I398T possibly damaging Het
Other mutations in Gbp11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Gbp11 APN 5 105327616 critical splice acceptor site probably null
IGL01347:Gbp11 APN 5 105331328 splice site probably benign
IGL01762:Gbp11 APN 5 105327607 missense probably benign
IGL02157:Gbp11 APN 5 105327508 missense possibly damaging 0.95
Quilt UTSW 5 105325508 missense probably damaging 1.00
Tilted UTSW 5 105331053 missense probably damaging 1.00
R0550:Gbp11 UTSW 5 105343750 missense probably benign 0.28
R0647:Gbp11 UTSW 5 105330964 missense possibly damaging 0.93
R1530:Gbp11 UTSW 5 105327489 missense probably damaging 0.99
R1612:Gbp11 UTSW 5 105326596 missense possibly damaging 0.72
R1677:Gbp11 UTSW 5 105327411 missense probably damaging 1.00
R1738:Gbp11 UTSW 5 105326644 missense probably benign 0.02
R2063:Gbp11 UTSW 5 105328584 nonsense probably null
R2869:Gbp11 UTSW 5 105331000 missense probably benign 0.00
R2869:Gbp11 UTSW 5 105331000 missense probably benign 0.00
R2870:Gbp11 UTSW 5 105331000 missense probably benign 0.00
R2870:Gbp11 UTSW 5 105331000 missense probably benign 0.00
R2873:Gbp11 UTSW 5 105331000 missense probably benign 0.00
R3915:Gbp11 UTSW 5 105331112 missense probably damaging 1.00
R4854:Gbp11 UTSW 5 105325508 missense probably damaging 1.00
R5140:Gbp11 UTSW 5 105331053 missense probably damaging 1.00
R5534:Gbp11 UTSW 5 105331038 missense probably damaging 1.00
R6091:Gbp11 UTSW 5 105331388 missense possibly damaging 0.95
R6336:Gbp11 UTSW 5 105325489
R6351:Gbp11 UTSW 5 105327598 missense probably benign 0.07
R6956:Gbp11 UTSW 5 105328375 critical splice donor site probably null
R7371:Gbp11 UTSW 5 105342105 missense probably benign 0.06
R7393:Gbp11 UTSW 5 105327577 missense possibly damaging 0.60
R7410:Gbp11 UTSW 5 105343908 missense probably damaging 1.00
R7443:Gbp11 UTSW 5 105330950 critical splice donor site probably null
R7898:Gbp11 UTSW 5 105324932 missense probably benign 0.00
R8465:Gbp11 UTSW 5 105325062 missense probably benign 0.00
R8467:Gbp11 UTSW 5 105327591 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTAGCATGAGAGGGTGGC -3'
(R):5'- GATTGGTCCTAGTCGCTGAG -3'

Sequencing Primer
(F):5'- GCTTTGCTAAAAAGGAGTTCTGC -3'
(R):5'- GTCCTAGTCGCTGAGCCATTG -3'
Posted On2021-03-08