Incidental Mutation 'R8672:Fzd9'
ID661207
Institutional Source Beutler Lab
Gene Symbol Fzd9
Ensembl Gene ENSMUSG00000049551
Gene Namefrizzled class receptor 9
Synonymsmfz9, frizzled 9
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R8672 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location135248938-135251230 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135249670 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 454 (I454V)
Ref Sequence ENSEMBL: ENSMUSP00000053551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002825] [ENSMUST00000062572]
Predicted Effect probably benign
Transcript: ENSMUST00000002825
SMART Domains Protein: ENSMUSP00000002825
Gene: ENSMUSG00000002748

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 21 120 2.6e-28 PFAM
low complexity region 312 335 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
coiled coil region 537 587 N/A INTRINSIC
DDT 605 669 5.59e-17 SMART
Pfam:WHIM1 725 773 2.2e-9 PFAM
low complexity region 822 835 N/A INTRINSIC
coiled coil region 854 890 N/A INTRINSIC
Pfam:WHIM2 900 935 1.3e-10 PFAM
Pfam:WHIM3 991 1029 1.5e-16 PFAM
low complexity region 1131 1148 N/A INTRINSIC
PHD 1186 1232 1.89e-14 SMART
RING 1187 1231 7.85e-2 SMART
low complexity region 1245 1277 N/A INTRINSIC
BROMO 1333 1441 3.63e-37 SMART
low complexity region 1459 1472 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062572
AA Change: I454V

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000053551
Gene: ENSMUSG00000049551
AA Change: I454V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FRI 39 158 1.97e-73 SMART
low complexity region 177 195 N/A INTRINSIC
Frizzled 222 548 4.64e-199 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the 'frizzled' gene family encode 7-transmembrane domain proteins that are receptors for Wnt signaling proteins. The FZD9 gene is located within the Williams syndrome common deletion region of chromosome 7, and heterozygous deletion of the FZD9 gene may contribute to the Williams syndrome phenotype. FZD9 is expressed predominantly in brain, testis, eye, skeletal muscle, and kidney. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one allele exhibit immune system abnormalities while another null allele causes neurological abnormalities. A third null mutation results in growth retardation and abnormalities in bone mineralization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik G T 17: 48,090,329 E45* probably null Het
4932415D10Rik A T 10: 82,291,892 N1761K probably benign Het
9930021J03Rik T C 19: 29,754,164 T483A probably benign Het
Aadat A T 8: 60,506,145 probably benign Het
Amigo3 A G 9: 108,054,176 H266R possibly damaging Het
Amy2a1 A T 3: 113,529,497 M214K probably damaging Het
Atp11b A T 3: 35,819,917 D685V probably benign Het
Aunip T A 4: 134,523,149 M135K probably benign Het
Card9 T C 2: 26,357,938 T134A probably benign Het
Cd46 G A 1: 195,082,641 T216I probably benign Het
Chit1 T C 1: 134,151,267 V360A unknown Het
Crcp A G 5: 130,042,236 R59G probably benign Het
Csmd1 T A 8: 15,926,598 E2873D probably benign Het
Cyp8b1 T A 9: 121,914,920 M449L probably benign Het
Dpp7 T C 2: 25,356,121 D40G probably benign Het
Eif4g3 T A 4: 138,126,512 L463Q possibly damaging Het
Gbp11 T A 5: 105,343,809 I41F probably damaging Het
Gkap1 G A 13: 58,243,848 T231I probably damaging Het
Heatr5b A G 17: 78,762,203 L1705P probably damaging Het
Herc3 T A 6: 58,873,801 F467I probably damaging Het
Ifih1 T C 2: 62,605,649 E699G possibly damaging Het
Ints5 T A 19: 8,896,006 L443Q probably damaging Het
Itpr2 A T 6: 146,374,518 C764S probably damaging Het
Kcnma1 A T 14: 23,501,162 I519N probably damaging Het
Krtap4-1 C T 11: 99,628,064 C40Y unknown Het
Mdn1 A G 4: 32,768,793 D5384G probably damaging Het
Mpl T C 4: 118,448,913 Y310C probably damaging Het
Mucl1 A G 15: 103,753,797 S48P possibly damaging Het
Musk T G 4: 58,286,051 probably benign Het
Nemp1 T C 10: 127,677,119 S8P probably benign Het
Nisch A G 14: 31,173,136 C1068R probably damaging Het
Npr3 T C 15: 11,851,493 N404D probably damaging Het
Nwd1 C G 8: 72,667,379 H423Q probably damaging Het
Olfr1062 T A 2: 86,423,632 M15L probably benign Het
Olfr76 C T 19: 12,120,557 V52M probably benign Het
Olfr792 T A 10: 129,540,727 N63K probably damaging Het
Pcdh9 T C 14: 93,887,093 N547S probably benign Het
Pdha2 C A 3: 141,211,363 R128L probably damaging Het
Pebp1 A G 5: 117,283,271 Y181H probably benign Het
Peg3 T G 7: 6,708,524 D1233A possibly damaging Het
Pepd C A 7: 34,942,682 T146N probably damaging Het
Ptk2b A T 14: 66,156,392 D877E probably benign Het
Rabgap1l A C 1: 160,443,276 M647R probably damaging Het
Rp1 A G 1: 4,348,784 S702P possibly damaging Het
Shb A T 4: 45,489,161 D238E probably damaging Het
Slc36a1 T A 11: 55,232,508 V433D possibly damaging Het
Spen C T 4: 141,470,370 A3396T probably benign Het
Tcerg1 A T 18: 42,553,494 K705N probably damaging Het
Thbs1 C A 2: 118,113,238 N112K probably benign Het
Zfp658 T C 7: 43,573,495 I398T possibly damaging Het
Other mutations in Fzd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Fzd9 APN 5 135249469 missense probably damaging 1.00
IGL01446:Fzd9 APN 5 135250566 missense probably damaging 1.00
IGL02510:Fzd9 APN 5 135249615 missense probably damaging 1.00
R0308:Fzd9 UTSW 5 135249406 missense probably damaging 0.97
R0417:Fzd9 UTSW 5 135249619 missense probably damaging 0.99
R1563:Fzd9 UTSW 5 135250554 missense probably damaging 0.96
R1638:Fzd9 UTSW 5 135249748 missense probably damaging 1.00
R1840:Fzd9 UTSW 5 135249571 missense probably benign
R2046:Fzd9 UTSW 5 135249684 missense probably damaging 1.00
R2268:Fzd9 UTSW 5 135250294 missense probably damaging 1.00
R2898:Fzd9 UTSW 5 135249846 missense probably damaging 1.00
R4078:Fzd9 UTSW 5 135249636 missense probably benign 0.01
R4079:Fzd9 UTSW 5 135249636 missense probably benign 0.01
R4576:Fzd9 UTSW 5 135250312 missense probably damaging 1.00
R4662:Fzd9 UTSW 5 135249621 missense probably damaging 1.00
R4956:Fzd9 UTSW 5 135249942 missense probably damaging 1.00
R5096:Fzd9 UTSW 5 135249859 missense probably damaging 0.96
R5227:Fzd9 UTSW 5 135249606 missense probably benign 0.06
R5452:Fzd9 UTSW 5 135250860 missense probably damaging 1.00
R5475:Fzd9 UTSW 5 135250269 splice site probably null
R5888:Fzd9 UTSW 5 135249463 splice site probably null
R5914:Fzd9 UTSW 5 135249345 missense probably benign
R7148:Fzd9 UTSW 5 135249690 missense probably benign 0.40
R7544:Fzd9 UTSW 5 135249862 missense probably damaging 1.00
R7638:Fzd9 UTSW 5 135250630 missense probably damaging 1.00
R8893:Fzd9 UTSW 5 135250324 missense possibly damaging 0.54
R8928:Fzd9 UTSW 5 135249735 missense probably damaging 1.00
X0063:Fzd9 UTSW 5 135249721 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AAGATTTTGAGCATGAAGACAGCC -3'
(R):5'- ATGAACTGACTGGGCTCTGC -3'

Sequencing Primer
(F):5'- AGACAGCCACAGTGGGCAC -3'
(R):5'- TATGTAGCCAGCATGGACCC -3'
Posted On2021-03-08