Incidental Mutation 'R8672:Herc3'
ID661208
Institutional Source Beutler Lab
Gene Symbol Herc3
Ensembl Gene ENSMUSG00000029804
Gene Namehect domain and RLD 3
Synonyms5730409F18Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8672 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location58831465-58920398 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58873801 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 467 (F467I)
Ref Sequence ENSEMBL: ENSMUSP00000040025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031823] [ENSMUST00000041401]
Predicted Effect probably damaging
Transcript: ENSMUST00000031823
AA Change: F467I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031823
Gene: ENSMUSG00000029804
AA Change: F467I

DomainStartEndE-ValueType
Pfam:RCC1_2 36 65 3.3e-11 PFAM
Pfam:RCC1 52 99 3.6e-15 PFAM
Pfam:RCC1_2 86 115 1.1e-10 PFAM
Pfam:RCC1 102 152 1.4e-16 PFAM
Pfam:RCC1_2 139 168 2.1e-9 PFAM
Pfam:RCC1 155 205 2.6e-16 PFAM
Pfam:RCC1_2 193 221 1.5e-9 PFAM
Pfam:RCC1 208 257 4.7e-17 PFAM
Pfam:RCC1_2 244 273 8e-9 PFAM
Pfam:RCC1 260 309 2.6e-16 PFAM
Pfam:RCC1_2 296 326 2.3e-7 PFAM
Pfam:RCC1 313 377 3.8e-9 PFAM
HECTc 721 913 2.08e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000041401
AA Change: F467I

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000040025
Gene: ENSMUSG00000029804
AA Change: F467I

DomainStartEndE-ValueType
Pfam:RCC1_2 36 65 1.7e-11 PFAM
Pfam:RCC1 52 99 1.6e-15 PFAM
Pfam:RCC1_2 86 115 1.1e-10 PFAM
Pfam:RCC1 102 152 7.3e-16 PFAM
Pfam:RCC1_2 139 168 1.3e-9 PFAM
Pfam:RCC1 155 205 1.4e-16 PFAM
Pfam:RCC1_2 193 221 5e-10 PFAM
Pfam:RCC1 208 257 1.4e-16 PFAM
Pfam:RCC1_2 244 273 6.1e-8 PFAM
Pfam:RCC1 260 309 1.7e-14 PFAM
Pfam:RCC1_2 296 326 1.1e-7 PFAM
Pfam:RCC1 313 377 6.6e-11 PFAM
HECTc 721 1050 5.79e-157 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member the HERC ubiquitin ligase family. The encoded protein is located in the cytosol and binds ubiquitin via a HECT domain. Mutations in this gene have been associated with colorectal and gastric carcinomas. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal hair follicle bulge morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik G T 17: 48,090,329 E45* probably null Het
4932415D10Rik A T 10: 82,291,892 N1761K probably benign Het
9930021J03Rik T C 19: 29,754,164 T483A probably benign Het
Aadat A T 8: 60,506,145 probably benign Het
Amigo3 A G 9: 108,054,176 H266R possibly damaging Het
Amy2a1 A T 3: 113,529,497 M214K probably damaging Het
Atp11b A T 3: 35,819,917 D685V probably benign Het
Aunip T A 4: 134,523,149 M135K probably benign Het
Card9 T C 2: 26,357,938 T134A probably benign Het
Cd46 G A 1: 195,082,641 T216I probably benign Het
Chit1 T C 1: 134,151,267 V360A unknown Het
Crcp A G 5: 130,042,236 R59G probably benign Het
Csmd1 T A 8: 15,926,598 E2873D probably benign Het
Cyp8b1 T A 9: 121,914,920 M449L probably benign Het
Dpp7 T C 2: 25,356,121 D40G probably benign Het
Eif4g3 T A 4: 138,126,512 L463Q possibly damaging Het
Fzd9 T C 5: 135,249,670 I454V probably benign Het
Gbp11 T A 5: 105,343,809 I41F probably damaging Het
Gkap1 G A 13: 58,243,848 T231I probably damaging Het
Heatr5b A G 17: 78,762,203 L1705P probably damaging Het
Ifih1 T C 2: 62,605,649 E699G possibly damaging Het
Ints5 T A 19: 8,896,006 L443Q probably damaging Het
Itpr2 A T 6: 146,374,518 C764S probably damaging Het
Kcnma1 A T 14: 23,501,162 I519N probably damaging Het
Krtap4-1 C T 11: 99,628,064 C40Y unknown Het
Mdn1 A G 4: 32,768,793 D5384G probably damaging Het
Mpl T C 4: 118,448,913 Y310C probably damaging Het
Mucl1 A G 15: 103,753,797 S48P possibly damaging Het
Musk T G 4: 58,286,051 probably benign Het
Nemp1 T C 10: 127,677,119 S8P probably benign Het
Nisch A G 14: 31,173,136 C1068R probably damaging Het
Npr3 T C 15: 11,851,493 N404D probably damaging Het
Nwd1 C G 8: 72,667,379 H423Q probably damaging Het
Olfr1062 T A 2: 86,423,632 M15L probably benign Het
Olfr76 C T 19: 12,120,557 V52M probably benign Het
Olfr792 T A 10: 129,540,727 N63K probably damaging Het
Pcdh9 T C 14: 93,887,093 N547S probably benign Het
Pdha2 C A 3: 141,211,363 R128L probably damaging Het
Pebp1 A G 5: 117,283,271 Y181H probably benign Het
Peg3 T G 7: 6,708,524 D1233A possibly damaging Het
Pepd C A 7: 34,942,682 T146N probably damaging Het
Ptk2b A T 14: 66,156,392 D877E probably benign Het
Rabgap1l A C 1: 160,443,276 M647R probably damaging Het
Rp1 A G 1: 4,348,784 S702P possibly damaging Het
Shb A T 4: 45,489,161 D238E probably damaging Het
Slc36a1 T A 11: 55,232,508 V433D possibly damaging Het
Spen C T 4: 141,470,370 A3396T probably benign Het
Tcerg1 A T 18: 42,553,494 K705N probably damaging Het
Thbs1 C A 2: 118,113,238 N112K probably benign Het
Zfp658 T C 7: 43,573,495 I398T possibly damaging Het
Other mutations in Herc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Herc3 APN 6 58874263 missense probably damaging 1.00
IGL00423:Herc3 APN 6 58868715 missense probably damaging 0.99
IGL00468:Herc3 APN 6 58918766 missense probably benign 0.04
IGL01153:Herc3 APN 6 58860336 missense probably benign 0.21
IGL01468:Herc3 APN 6 58854895 missense probably benign 0.00
IGL01696:Herc3 APN 6 58860386 missense possibly damaging 0.58
IGL01975:Herc3 APN 6 58916576 missense possibly damaging 0.91
IGL02797:Herc3 APN 6 58868694 missense probably benign
IGL02953:Herc3 APN 6 58857733 nonsense probably null
aegean UTSW 6 58855760 nonsense probably null
PIT4519001:Herc3 UTSW 6 58876811 missense probably damaging 1.00
R0019:Herc3 UTSW 6 58885065 splice site probably benign
R0019:Herc3 UTSW 6 58885065 splice site probably benign
R0025:Herc3 UTSW 6 58874308 missense probably damaging 1.00
R0025:Herc3 UTSW 6 58874308 missense probably damaging 1.00
R0268:Herc3 UTSW 6 58868628 splice site probably benign
R0334:Herc3 UTSW 6 58918817 missense probably damaging 1.00
R0344:Herc3 UTSW 6 58868628 splice site probably benign
R0853:Herc3 UTSW 6 58876564 missense probably damaging 1.00
R0927:Herc3 UTSW 6 58868763 missense possibly damaging 0.48
R1333:Herc3 UTSW 6 58887493 missense probably damaging 1.00
R1432:Herc3 UTSW 6 58916842 missense possibly damaging 0.49
R1450:Herc3 UTSW 6 58876515 nonsense probably null
R1594:Herc3 UTSW 6 58887584 unclassified probably benign
R1757:Herc3 UTSW 6 58916470 missense probably damaging 1.00
R1765:Herc3 UTSW 6 58888660 missense probably damaging 0.99
R1932:Herc3 UTSW 6 58876793 missense probably damaging 0.99
R1945:Herc3 UTSW 6 58887439 missense probably damaging 0.96
R1988:Herc3 UTSW 6 58884975 critical splice donor site probably null
R2172:Herc3 UTSW 6 58887437 missense probably damaging 1.00
R3080:Herc3 UTSW 6 58856646 splice site probably null
R3545:Herc3 UTSW 6 58856685 missense probably damaging 1.00
R3767:Herc3 UTSW 6 58862988 missense probably benign
R3767:Herc3 UTSW 6 58876602 missense probably benign 0.00
R3805:Herc3 UTSW 6 58916850 missense probably damaging 1.00
R3806:Herc3 UTSW 6 58916850 missense probably damaging 1.00
R4049:Herc3 UTSW 6 58876837 missense probably damaging 0.99
R4250:Herc3 UTSW 6 58916516 missense probably damaging 1.00
R4469:Herc3 UTSW 6 58876809 nonsense probably null
R4534:Herc3 UTSW 6 58860347 missense probably benign
R4573:Herc3 UTSW 6 58894113 missense possibly damaging 0.89
R4887:Herc3 UTSW 6 58887499 missense probably damaging 1.00
R5047:Herc3 UTSW 6 58855760 nonsense probably null
R5049:Herc3 UTSW 6 58894539 splice site probably null
R5062:Herc3 UTSW 6 58855760 nonsense probably null
R5063:Herc3 UTSW 6 58855760 nonsense probably null
R5288:Herc3 UTSW 6 58874278 missense probably damaging 0.99
R5297:Herc3 UTSW 6 58856641 missense probably damaging 1.00
R5386:Herc3 UTSW 6 58874278 missense probably damaging 0.99
R5435:Herc3 UTSW 6 58855806 missense probably damaging 1.00
R5576:Herc3 UTSW 6 58888725 missense probably benign 0.08
R5605:Herc3 UTSW 6 58857727 missense probably damaging 1.00
R5719:Herc3 UTSW 6 58894543 missense possibly damaging 0.67
R5743:Herc3 UTSW 6 58918799 missense probably benign 0.12
R5870:Herc3 UTSW 6 58916450 missense probably benign 0.01
R6460:Herc3 UTSW 6 58890123 missense probably damaging 1.00
R6930:Herc3 UTSW 6 58916459 missense probably damaging 0.98
R7034:Herc3 UTSW 6 58876855 missense probably benign 0.00
R7131:Herc3 UTSW 6 58887424 missense probably damaging 1.00
R7187:Herc3 UTSW 6 58856631 missense probably benign 0.42
R7212:Herc3 UTSW 6 58918773 missense probably damaging 1.00
R7335:Herc3 UTSW 6 58876788 missense possibly damaging 0.95
R7349:Herc3 UTSW 6 58858986 missense probably benign
R7568:Herc3 UTSW 6 58843810 missense probably benign 0.01
R7857:Herc3 UTSW 6 58843652 nonsense probably null
R8321:Herc3 UTSW 6 58843769 missense possibly damaging 0.93
R8684:Herc3 UTSW 6 58887576 missense probably damaging 1.00
Z1176:Herc3 UTSW 6 58843858 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATCTGTCTAGACTGGGTTAGC -3'
(R):5'- TCAGACACCCAGTACATCGG -3'

Sequencing Primer
(F):5'- GGATTtttgcttgtttgtttg -3'
(R):5'- CTTTAGAGAGACAACTCCTTAGGAAG -3'
Posted On2021-03-08