Incidental Mutation 'R8672:Nemp1'
ID661219
Institutional Source Beutler Lab
Gene Symbol Nemp1
Ensembl Gene ENSMUSG00000040195
Gene Namenuclear envelope integral membrane protein 1
SynonymsTmem194
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8672 (G1)
Quality Score218.009
Status Not validated
Chromosome10
Chromosomal Location127666901-127701049 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127677119 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 8 (S8P)
Ref Sequence ENSEMBL: ENSMUSP00000045988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048099] [ENSMUST00000118612] [ENSMUST00000118728]
Predicted Effect probably benign
Transcript: ENSMUST00000048099
AA Change: S8P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045988
Gene: ENSMUSG00000040195
AA Change: S8P

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:DUF2215 150 396 1.2e-94 PFAM
low complexity region 416 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118612
AA Change: S8P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113337
Gene: ENSMUSG00000040195
AA Change: S8P

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:DUF2215 149 325 4.2e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118728
SMART Domains Protein: ENSMUSP00000113473
Gene: ENSMUSG00000040195

DomainStartEndE-ValueType
Pfam:DUF2215 100 348 7.2e-105 PFAM
low complexity region 367 377 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik G T 17: 48,090,329 E45* probably null Het
4932415D10Rik A T 10: 82,291,892 N1761K probably benign Het
9930021J03Rik T C 19: 29,754,164 T483A probably benign Het
Aadat A T 8: 60,506,145 probably benign Het
Amigo3 A G 9: 108,054,176 H266R possibly damaging Het
Amy2a1 A T 3: 113,529,497 M214K probably damaging Het
Atp11b A T 3: 35,819,917 D685V probably benign Het
Aunip T A 4: 134,523,149 M135K probably benign Het
Card9 T C 2: 26,357,938 T134A probably benign Het
Cd46 G A 1: 195,082,641 T216I probably benign Het
Chit1 T C 1: 134,151,267 V360A unknown Het
Crcp A G 5: 130,042,236 R59G probably benign Het
Csmd1 T A 8: 15,926,598 E2873D probably benign Het
Cyp8b1 T A 9: 121,914,920 M449L probably benign Het
Dpp7 T C 2: 25,356,121 D40G probably benign Het
Eif4g3 T A 4: 138,126,512 L463Q possibly damaging Het
Fzd9 T C 5: 135,249,670 I454V probably benign Het
Gbp11 T A 5: 105,343,809 I41F probably damaging Het
Gkap1 G A 13: 58,243,848 T231I probably damaging Het
Heatr5b A G 17: 78,762,203 L1705P probably damaging Het
Herc3 T A 6: 58,873,801 F467I probably damaging Het
Ifih1 T C 2: 62,605,649 E699G possibly damaging Het
Ints5 T A 19: 8,896,006 L443Q probably damaging Het
Itpr2 A T 6: 146,374,518 C764S probably damaging Het
Kcnma1 A T 14: 23,501,162 I519N probably damaging Het
Krtap4-1 C T 11: 99,628,064 C40Y unknown Het
Mdn1 A G 4: 32,768,793 D5384G probably damaging Het
Mpl T C 4: 118,448,913 Y310C probably damaging Het
Mucl1 A G 15: 103,753,797 S48P possibly damaging Het
Musk T G 4: 58,286,051 probably benign Het
Nisch A G 14: 31,173,136 C1068R probably damaging Het
Npr3 T C 15: 11,851,493 N404D probably damaging Het
Nwd1 C G 8: 72,667,379 H423Q probably damaging Het
Olfr1062 T A 2: 86,423,632 M15L probably benign Het
Olfr76 C T 19: 12,120,557 V52M probably benign Het
Olfr792 T A 10: 129,540,727 N63K probably damaging Het
Pcdh9 T C 14: 93,887,093 N547S probably benign Het
Pdha2 C A 3: 141,211,363 R128L probably damaging Het
Pebp1 A G 5: 117,283,271 Y181H probably benign Het
Peg3 T G 7: 6,708,524 D1233A possibly damaging Het
Pepd C A 7: 34,942,682 T146N probably damaging Het
Ptk2b A T 14: 66,156,392 D877E probably benign Het
Rabgap1l A C 1: 160,443,276 M647R probably damaging Het
Rp1 A G 1: 4,348,784 S702P possibly damaging Het
Shb A T 4: 45,489,161 D238E probably damaging Het
Slc36a1 T A 11: 55,232,508 V433D possibly damaging Het
Spen C T 4: 141,470,370 A3396T probably benign Het
Tcerg1 A T 18: 42,553,494 K705N probably damaging Het
Thbs1 C A 2: 118,113,238 N112K probably benign Het
Zfp658 T C 7: 43,573,495 I398T possibly damaging Het
Other mutations in Nemp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02172:Nemp1 APN 10 127692999 missense probably benign 0.02
Assassin UTSW 10 127689343 nonsense probably null
Brightside UTSW 10 127689450 splice site probably null
Cheery UTSW 10 127677198 missense possibly damaging 0.86
PIT4453001:Nemp1 UTSW 10 127696254 missense probably benign 0.00
R0815:Nemp1 UTSW 10 127693024 missense probably damaging 0.99
R1719:Nemp1 UTSW 10 127696248 missense probably damaging 1.00
R2007:Nemp1 UTSW 10 127693577 missense probably benign 0.02
R2042:Nemp1 UTSW 10 127696334 missense possibly damaging 0.46
R3938:Nemp1 UTSW 10 127695473 missense probably damaging 1.00
R4548:Nemp1 UTSW 10 127696344 missense probably benign 0.00
R4726:Nemp1 UTSW 10 127694593 missense probably benign 0.01
R4981:Nemp1 UTSW 10 127693530 missense probably damaging 1.00
R5048:Nemp1 UTSW 10 127690935 critical splice donor site probably null
R5784:Nemp1 UTSW 10 127677198 missense possibly damaging 0.86
R6073:Nemp1 UTSW 10 127689243 missense probably benign 0.01
R6171:Nemp1 UTSW 10 127689450 splice site probably null
R6294:Nemp1 UTSW 10 127694522 missense possibly damaging 0.87
R7249:Nemp1 UTSW 10 127693526 missense probably damaging 1.00
R7269:Nemp1 UTSW 10 127695476 missense probably damaging 1.00
R7316:Nemp1 UTSW 10 127689343 nonsense probably null
R7468:Nemp1 UTSW 10 127693054 missense possibly damaging 0.56
R7998:Nemp1 UTSW 10 127693489 missense probably damaging 1.00
R8342:Nemp1 UTSW 10 127693029 missense probably benign 0.00
R8756:Nemp1 UTSW 10 127692976 missense probably benign 0.30
X0011:Nemp1 UTSW 10 127689311 nonsense probably null
Z1177:Nemp1 UTSW 10 127693519 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTCGTCACTGCCAGGATTG -3'
(R):5'- CTCGGGATAAGAAACCACTTTTCC -3'

Sequencing Primer
(F):5'- CCAGGATTGGCGTTGCTAG -3'
(R):5'- GAAACCACTTTTCCACATTTAACG -3'
Posted On2021-03-08