Incidental Mutation 'R8672:Nisch'
ID661225
Institutional Source Beutler Lab
Gene Symbol Nisch
Ensembl Gene ENSMUSG00000021910
Gene Namenischarin
Synonyms1200007D05Rik, 3202002H23Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8672 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location31170930-31216946 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31173136 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 1068 (C1068R)
Ref Sequence ENSEMBL: ENSMUSP00000132842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022469] [ENSMUST00000036618] [ENSMUST00000167449] [ENSMUST00000168206] [ENSMUST00000169628]
Predicted Effect probably damaging
Transcript: ENSMUST00000022469
AA Change: C1313R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022469
Gene: ENSMUSG00000021910
AA Change: C1313R

DomainStartEndE-ValueType
PX 15 119 2.17e-26 SMART
PDB:4PQ8|A 287 420 9e-8 PDB
SCOP:d1h6ta2 291 421 6e-29 SMART
Blast:LRR 311 332 5e-6 BLAST
Blast:LRR 333 355 6e-6 BLAST
Blast:LRR 378 403 5e-7 BLAST
Blast:LRR 403 429 6e-7 BLAST
low complexity region 489 501 N/A INTRINSIC
low complexity region 517 534 N/A INTRINSIC
coiled coil region 625 650 N/A INTRINSIC
low complexity region 662 695 N/A INTRINSIC
low complexity region 1038 1069 N/A INTRINSIC
low complexity region 1081 1193 N/A INTRINSIC
low complexity region 1491 1509 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036618
SMART Domains Protein: ENSMUSP00000046199
Gene: ENSMUSG00000042286

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 112 149 6.65e-2 SMART
EGF 160 194 2.28e0 SMART
EGF 199 232 1.4e0 SMART
EGF 236 272 4.97e-1 SMART
EGF 276 319 1.95e1 SMART
EGF_like 321 357 5.03e1 SMART
low complexity region 400 413 N/A INTRINSIC
Blast:FAS1 414 501 2e-52 BLAST
FAS1 543 645 1.35e-24 SMART
EGF_like 780 817 5.45e1 SMART
EGF 822 861 1.08e-1 SMART
EGF 865 904 3.15e-3 SMART
EGF 908 947 1.3e1 SMART
EGF 951 989 1.47e1 SMART
FAS1 1023 1122 1.3e-17 SMART
FAS1 1165 1257 2.94e0 SMART
EGF 1332 1369 1.4e0 SMART
EGF 1379 1413 1.88e-1 SMART
EGF 1420 1455 6.02e0 SMART
EGF 1459 1497 3.82e-2 SMART
EGF 1501 1540 2.05e-2 SMART
EGF 1544 1583 2.25e1 SMART
FAS1 1616 1712 1.61e-22 SMART
FAS1 1763 1868 2.12e-17 SMART
EGF 1970 2007 1.26e-2 SMART
EGF 2017 2051 1.61e0 SMART
EGF 2059 2090 2.45e0 SMART
EGF 2094 2131 3.46e0 SMART
EGF 2135 2174 3.82e-2 SMART
LINK 2206 2301 8.55e-49 SMART
FAS1 2367 2462 2.06e-6 SMART
transmembrane domain 2476 2498 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167449
AA Change: C67R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000168206
AA Change: C1068R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132842
Gene: ENSMUSG00000021910
AA Change: C1068R

DomainStartEndE-ValueType
Pfam:LRR_8 44 101 3.9e-9 PFAM
Pfam:LRR_1 45 66 2.6e-2 PFAM
Pfam:LRR_6 88 109 1.1e-2 PFAM
Pfam:LRR_4 89 132 6.5e-8 PFAM
Pfam:LRR_1 90 109 6.9e-2 PFAM
Blast:LRR 133 158 4e-7 BLAST
Blast:LRR 158 184 6e-7 BLAST
low complexity region 244 256 N/A INTRINSIC
low complexity region 272 289 N/A INTRINSIC
coiled coil region 380 405 N/A INTRINSIC
low complexity region 417 450 N/A INTRINSIC
low complexity region 793 824 N/A INTRINSIC
low complexity region 836 948 N/A INTRINSIC
low complexity region 1246 1264 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169628
AA Change: C81R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131465
Gene: ENSMUSG00000021910
AA Change: C81R

DomainStartEndE-ValueType
low complexity region 231 249 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170253
SMART Domains Protein: ENSMUSP00000129547
Gene: ENSMUSG00000021910

DomainStartEndE-ValueType
SCOP:d1dcea3 2 86 3e-11 SMART
Blast:LRR 13 34 1e-5 BLAST
Blast:LRR 35 60 1e-7 BLAST
Blast:LRR 60 86 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000170436
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for either a knock-out or hypomorphic allele exhibit hearing loss associated with increased susceptibility to otitis media. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik G T 17: 48,090,329 E45* probably null Het
4932415D10Rik A T 10: 82,291,892 N1761K probably benign Het
9930021J03Rik T C 19: 29,754,164 T483A probably benign Het
Aadat A T 8: 60,506,145 probably benign Het
Amigo3 A G 9: 108,054,176 H266R possibly damaging Het
Amy2a1 A T 3: 113,529,497 M214K probably damaging Het
Atp11b A T 3: 35,819,917 D685V probably benign Het
Aunip T A 4: 134,523,149 M135K probably benign Het
Card9 T C 2: 26,357,938 T134A probably benign Het
Cd46 G A 1: 195,082,641 T216I probably benign Het
Chit1 T C 1: 134,151,267 V360A unknown Het
Crcp A G 5: 130,042,236 R59G probably benign Het
Csmd1 T A 8: 15,926,598 E2873D probably benign Het
Cyp8b1 T A 9: 121,914,920 M449L probably benign Het
Dpp7 T C 2: 25,356,121 D40G probably benign Het
Eif4g3 T A 4: 138,126,512 L463Q possibly damaging Het
Fzd9 T C 5: 135,249,670 I454V probably benign Het
Gbp11 T A 5: 105,343,809 I41F probably damaging Het
Gkap1 G A 13: 58,243,848 T231I probably damaging Het
Heatr5b A G 17: 78,762,203 L1705P probably damaging Het
Herc3 T A 6: 58,873,801 F467I probably damaging Het
Ifih1 T C 2: 62,605,649 E699G possibly damaging Het
Ints5 T A 19: 8,896,006 L443Q probably damaging Het
Itpr2 A T 6: 146,374,518 C764S probably damaging Het
Kcnma1 A T 14: 23,501,162 I519N probably damaging Het
Krtap4-1 C T 11: 99,628,064 C40Y unknown Het
Mdn1 A G 4: 32,768,793 D5384G probably damaging Het
Mpl T C 4: 118,448,913 Y310C probably damaging Het
Mucl1 A G 15: 103,753,797 S48P possibly damaging Het
Musk T G 4: 58,286,051 probably benign Het
Nemp1 T C 10: 127,677,119 S8P probably benign Het
Npr3 T C 15: 11,851,493 N404D probably damaging Het
Nwd1 C G 8: 72,667,379 H423Q probably damaging Het
Olfr1062 T A 2: 86,423,632 M15L probably benign Het
Olfr76 C T 19: 12,120,557 V52M probably benign Het
Olfr792 T A 10: 129,540,727 N63K probably damaging Het
Pcdh9 T C 14: 93,887,093 N547S probably benign Het
Pdha2 C A 3: 141,211,363 R128L probably damaging Het
Pebp1 A G 5: 117,283,271 Y181H probably benign Het
Peg3 T G 7: 6,708,524 D1233A possibly damaging Het
Pepd C A 7: 34,942,682 T146N probably damaging Het
Ptk2b A T 14: 66,156,392 D877E probably benign Het
Rabgap1l A C 1: 160,443,276 M647R probably damaging Het
Rp1 A G 1: 4,348,784 S702P possibly damaging Het
Shb A T 4: 45,489,161 D238E probably damaging Het
Slc36a1 T A 11: 55,232,508 V433D possibly damaging Het
Spen C T 4: 141,470,370 A3396T probably benign Het
Tcerg1 A T 18: 42,553,494 K705N probably damaging Het
Thbs1 C A 2: 118,113,238 N112K probably benign Het
Zfp658 T C 7: 43,573,495 I398T possibly damaging Het
Other mutations in Nisch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Nisch APN 14 31176639 unclassified probably benign
IGL01934:Nisch APN 14 31176739 unclassified probably benign
IGL02201:Nisch APN 14 31187094 unclassified probably benign
IGL02964:Nisch APN 14 31180812 unclassified probably benign
IGL03340:Nisch APN 14 31173144 missense probably damaging 0.98
R0092:Nisch UTSW 14 31191453 unclassified probably benign
R0119:Nisch UTSW 14 31171924 missense probably damaging 1.00
R0196:Nisch UTSW 14 31203394 unclassified probably benign
R0299:Nisch UTSW 14 31171924 missense probably damaging 1.00
R0452:Nisch UTSW 14 31177464 utr 3 prime probably benign
R1529:Nisch UTSW 14 31180938 unclassified probably benign
R1643:Nisch UTSW 14 31173168 missense probably damaging 1.00
R1656:Nisch UTSW 14 31177271 unclassified probably benign
R1663:Nisch UTSW 14 31191521 unclassified probably benign
R1676:Nisch UTSW 14 31180902 unclassified probably benign
R1750:Nisch UTSW 14 31174882 unclassified probably benign
R1799:Nisch UTSW 14 31177271 unclassified probably benign
R1824:Nisch UTSW 14 31176432 unclassified probably benign
R1876:Nisch UTSW 14 31173637 missense probably damaging 1.00
R2107:Nisch UTSW 14 31172140 missense probably damaging 0.99
R2117:Nisch UTSW 14 31177285 unclassified probably benign
R2276:Nisch UTSW 14 31176846 unclassified probably benign
R2402:Nisch UTSW 14 31185014 intron probably benign
R3703:Nisch UTSW 14 31176745 unclassified probably benign
R3704:Nisch UTSW 14 31176745 unclassified probably benign
R3705:Nisch UTSW 14 31176745 unclassified probably benign
R3897:Nisch UTSW 14 31191000 unclassified probably benign
R4024:Nisch UTSW 14 31176819 unclassified probably benign
R4412:Nisch UTSW 14 31186658 intron probably benign
R4752:Nisch UTSW 14 31192588 missense probably damaging 1.00
R4832:Nisch UTSW 14 31177630 utr 3 prime probably benign
R5009:Nisch UTSW 14 31187229 unclassified probably benign
R5043:Nisch UTSW 14 31176465 unclassified probably benign
R5062:Nisch UTSW 14 31172440 missense probably damaging 0.99
R5254:Nisch UTSW 14 31206567 splice site probably null
R5754:Nisch UTSW 14 31191416 unclassified probably benign
R5906:Nisch UTSW 14 31172028 splice site probably null
R5930:Nisch UTSW 14 31173145 missense probably benign 0.11
R6246:Nisch UTSW 14 31172559 missense probably damaging 1.00
R6258:Nisch UTSW 14 31177128 unclassified probably benign
R6260:Nisch UTSW 14 31177128 unclassified probably benign
R6327:Nisch UTSW 14 31171487 utr 3 prime probably benign
R6671:Nisch UTSW 14 31204463 unclassified probably benign
R6874:Nisch UTSW 14 31176684 unclassified probably benign
R6887:Nisch UTSW 14 31185344 unclassified probably benign
R7273:Nisch UTSW 14 31174407 missense unknown
R7401:Nisch UTSW 14 31206580 missense probably benign 0.18
R7423:Nisch UTSW 14 31171701 missense probably benign 0.09
R7822:Nisch UTSW 14 31174651 unclassified probably benign
R7870:Nisch UTSW 14 31172095 missense probably damaging 1.00
R7887:Nisch UTSW 14 31176695 nonsense probably null
R8215:Nisch UTSW 14 31186701 missense possibly damaging 0.59
X0027:Nisch UTSW 14 31187084 unclassified probably benign
Z1177:Nisch UTSW 14 31177438 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATCTCAGCACTTCCCGAAGC -3'
(R):5'- CCGAGCTAAGCAAGATGAGACTC -3'

Sequencing Primer
(F):5'- CTTGTAAGTGGAGATATATGTGTCAC -3'
(R):5'- TCATCCCCACACCCAGTGTC -3'
Posted On2021-03-08