Incidental Mutation 'R8672:Npr3'
ID661228
Institutional Source Beutler Lab
Gene Symbol Npr3
Ensembl Gene ENSMUSG00000022206
Gene Namenatriuretic peptide receptor 3
Synonymslongjohn, NPR-C, B430320C24Rik, Nppc receptor, lgj
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.638) question?
Stock #R8672 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location11839896-11907287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11851493 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 404 (N404D)
Ref Sequence ENSEMBL: ENSMUSP00000066737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066529] [ENSMUST00000228489] [ENSMUST00000228603]
Predicted Effect probably damaging
Transcript: ENSMUST00000066529
AA Change: N404D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066737
Gene: ENSMUSG00000022206
AA Change: N404D

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
Pfam:ANF_receptor 66 417 1e-59 PFAM
transmembrane domain 477 499 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000228489
AA Change: N150D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000228603
AA Change: N404D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of three natriuretic peptide receptors. Natriutetic peptides are small peptides which regulate blood volume and pressure, pulmonary hypertension, and cardiac function as well as some metabolic and growth processes. The product of this gene encodes a natriuretic peptide receptor responsible for clearing circulating and extracellular natriuretic peptides through endocytosis of the receptor. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous inactivation of this gene leads to partial postnatal lethality, altered blood homeostasis, polyuria, hypovolemia, hypotension, increased bone turnover, skeletal deformities and altered adipose morphology. Spontaneous and ENU-induced mutations cause a skeletal-overgrowth phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik G T 17: 48,090,329 E45* probably null Het
4932415D10Rik A T 10: 82,291,892 N1761K probably benign Het
9930021J03Rik T C 19: 29,754,164 T483A probably benign Het
Aadat A T 8: 60,506,145 probably benign Het
Amigo3 A G 9: 108,054,176 H266R possibly damaging Het
Amy2a1 A T 3: 113,529,497 M214K probably damaging Het
Atp11b A T 3: 35,819,917 D685V probably benign Het
Aunip T A 4: 134,523,149 M135K probably benign Het
Card9 T C 2: 26,357,938 T134A probably benign Het
Cd46 G A 1: 195,082,641 T216I probably benign Het
Chit1 T C 1: 134,151,267 V360A unknown Het
Crcp A G 5: 130,042,236 R59G probably benign Het
Csmd1 T A 8: 15,926,598 E2873D probably benign Het
Cyp8b1 T A 9: 121,914,920 M449L probably benign Het
Dpp7 T C 2: 25,356,121 D40G probably benign Het
Eif4g3 T A 4: 138,126,512 L463Q possibly damaging Het
Fzd9 T C 5: 135,249,670 I454V probably benign Het
Gbp11 T A 5: 105,343,809 I41F probably damaging Het
Gkap1 G A 13: 58,243,848 T231I probably damaging Het
Heatr5b A G 17: 78,762,203 L1705P probably damaging Het
Herc3 T A 6: 58,873,801 F467I probably damaging Het
Ifih1 T C 2: 62,605,649 E699G possibly damaging Het
Ints5 T A 19: 8,896,006 L443Q probably damaging Het
Itpr2 A T 6: 146,374,518 C764S probably damaging Het
Kcnma1 A T 14: 23,501,162 I519N probably damaging Het
Krtap4-1 C T 11: 99,628,064 C40Y unknown Het
Mdn1 A G 4: 32,768,793 D5384G probably damaging Het
Mpl T C 4: 118,448,913 Y310C probably damaging Het
Mucl1 A G 15: 103,753,797 S48P possibly damaging Het
Musk T G 4: 58,286,051 probably benign Het
Nemp1 T C 10: 127,677,119 S8P probably benign Het
Nisch A G 14: 31,173,136 C1068R probably damaging Het
Nwd1 C G 8: 72,667,379 H423Q probably damaging Het
Olfr1062 T A 2: 86,423,632 M15L probably benign Het
Olfr76 C T 19: 12,120,557 V52M probably benign Het
Olfr792 T A 10: 129,540,727 N63K probably damaging Het
Pcdh9 T C 14: 93,887,093 N547S probably benign Het
Pdha2 C A 3: 141,211,363 R128L probably damaging Het
Pebp1 A G 5: 117,283,271 Y181H probably benign Het
Peg3 T G 7: 6,708,524 D1233A possibly damaging Het
Pepd C A 7: 34,942,682 T146N probably damaging Het
Ptk2b A T 14: 66,156,392 D877E probably benign Het
Rabgap1l A C 1: 160,443,276 M647R probably damaging Het
Rp1 A G 1: 4,348,784 S702P possibly damaging Het
Shb A T 4: 45,489,161 D238E probably damaging Het
Slc36a1 T A 11: 55,232,508 V433D possibly damaging Het
Spen C T 4: 141,470,370 A3396T probably benign Het
Tcerg1 A T 18: 42,553,494 K705N probably damaging Het
Thbs1 C A 2: 118,113,238 N112K probably benign Het
Zfp658 T C 7: 43,573,495 I398T possibly damaging Het
Other mutations in Npr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Npr3 APN 15 11895694 missense probably damaging 1.00
IGL01420:Npr3 APN 15 11858632 missense probably damaging 1.00
IGL01599:Npr3 APN 15 11895789 missense probably damaging 1.00
IGL01977:Npr3 APN 15 11858718 missense probably damaging 1.00
eel UTSW 15 11858647 missense probably damaging 0.99
Electric UTSW 15 11848603 missense possibly damaging 0.73
Morray UTSW 15 11851450 missense probably damaging 0.99
R0581:Npr3 UTSW 15 11851450 missense probably damaging 0.99
R0607:Npr3 UTSW 15 11845282 missense probably benign 0.32
R1554:Npr3 UTSW 15 11848563 missense probably benign
R1779:Npr3 UTSW 15 11851486 missense probably damaging 1.00
R1793:Npr3 UTSW 15 11848579 missense probably benign 0.05
R1968:Npr3 UTSW 15 11904969 missense probably benign 0.31
R2379:Npr3 UTSW 15 11883363 missense probably damaging 0.99
R2883:Npr3 UTSW 15 11883324 missense possibly damaging 0.50
R3080:Npr3 UTSW 15 11905149 missense probably benign 0.01
R3745:Npr3 UTSW 15 11905491 missense probably damaging 1.00
R3803:Npr3 UTSW 15 11895790 missense probably damaging 1.00
R4166:Npr3 UTSW 15 11848513 missense probably benign 0.32
R4411:Npr3 UTSW 15 11905149 missense probably benign 0.01
R4412:Npr3 UTSW 15 11905149 missense probably benign 0.01
R4667:Npr3 UTSW 15 11905467 missense possibly damaging 0.58
R5209:Npr3 UTSW 15 11848603 missense possibly damaging 0.73
R5742:Npr3 UTSW 15 11883408 missense probably damaging 1.00
R6339:Npr3 UTSW 15 11845275 missense probably damaging 0.99
R6605:Npr3 UTSW 15 11905432 missense probably damaging 1.00
R6890:Npr3 UTSW 15 11883392 missense possibly damaging 0.89
R7009:Npr3 UTSW 15 11905248 missense probably damaging 1.00
R7371:Npr3 UTSW 15 11845290 critical splice acceptor site probably null
R7582:Npr3 UTSW 15 11895682 missense probably null 1.00
R7743:Npr3 UTSW 15 11905638 start codon destroyed probably null 0.90
R7896:Npr3 UTSW 15 11883362 missense probably damaging 1.00
R8840:Npr3 UTSW 15 11905243 missense probably damaging 0.98
S24628:Npr3 UTSW 15 11848563 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAGCTTTCACTGCATGGAAAG -3'
(R):5'- ACATTGTTTCGGCATGGTCC -3'

Sequencing Primer
(F):5'- TGCATGGAAAGGTTCATTTTTATTTG -3'
(R):5'- AGAGGCACCATAAGTCTC -3'
Posted On2021-03-08