Incidental Mutation 'R8672:Heatr5b'
ID661231
Institutional Source Beutler Lab
Gene Symbol Heatr5b
Ensembl Gene ENSMUSG00000039414
Gene NameHEAT repeat containing 5B
Synonyms2010013B10Rik, A230048G03Rik, D330050P16Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.641) question?
Stock #R8672 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location78752906-78835381 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78762203 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1705 (L1705P)
Ref Sequence ENSEMBL: ENSMUSP00000094882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097281]
Predicted Effect probably damaging
Transcript: ENSMUST00000097281
AA Change: L1705P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000094882
Gene: ENSMUSG00000039414
AA Change: L1705P

DomainStartEndE-ValueType
SCOP:d1qbkb_ 46 491 4e-6 SMART
SCOP:d1qbkb_ 846 1338 2e-16 SMART
low complexity region 1641 1650 N/A INTRINSIC
low complexity region 2039 2057 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik G T 17: 48,090,329 E45* probably null Het
4932415D10Rik A T 10: 82,291,892 N1761K probably benign Het
9930021J03Rik T C 19: 29,754,164 T483A probably benign Het
Aadat A T 8: 60,506,145 probably benign Het
Amigo3 A G 9: 108,054,176 H266R possibly damaging Het
Amy2a1 A T 3: 113,529,497 M214K probably damaging Het
Atp11b A T 3: 35,819,917 D685V probably benign Het
Aunip T A 4: 134,523,149 M135K probably benign Het
Card9 T C 2: 26,357,938 T134A probably benign Het
Cd46 G A 1: 195,082,641 T216I probably benign Het
Chit1 T C 1: 134,151,267 V360A unknown Het
Crcp A G 5: 130,042,236 R59G probably benign Het
Csmd1 T A 8: 15,926,598 E2873D probably benign Het
Cyp8b1 T A 9: 121,914,920 M449L probably benign Het
Dpp7 T C 2: 25,356,121 D40G probably benign Het
Eif4g3 T A 4: 138,126,512 L463Q possibly damaging Het
Fzd9 T C 5: 135,249,670 I454V probably benign Het
Gbp11 T A 5: 105,343,809 I41F probably damaging Het
Gkap1 G A 13: 58,243,848 T231I probably damaging Het
Herc3 T A 6: 58,873,801 F467I probably damaging Het
Ifih1 T C 2: 62,605,649 E699G possibly damaging Het
Ints5 T A 19: 8,896,006 L443Q probably damaging Het
Itpr2 A T 6: 146,374,518 C764S probably damaging Het
Kcnma1 A T 14: 23,501,162 I519N probably damaging Het
Krtap4-1 C T 11: 99,628,064 C40Y unknown Het
Mdn1 A G 4: 32,768,793 D5384G probably damaging Het
Mpl T C 4: 118,448,913 Y310C probably damaging Het
Mucl1 A G 15: 103,753,797 S48P possibly damaging Het
Musk T G 4: 58,286,051 probably benign Het
Nemp1 T C 10: 127,677,119 S8P probably benign Het
Nisch A G 14: 31,173,136 C1068R probably damaging Het
Npr3 T C 15: 11,851,493 N404D probably damaging Het
Nwd1 C G 8: 72,667,379 H423Q probably damaging Het
Olfr1062 T A 2: 86,423,632 M15L probably benign Het
Olfr76 C T 19: 12,120,557 V52M probably benign Het
Olfr792 T A 10: 129,540,727 N63K probably damaging Het
Pcdh9 T C 14: 93,887,093 N547S probably benign Het
Pdha2 C A 3: 141,211,363 R128L probably damaging Het
Pebp1 A G 5: 117,283,271 Y181H probably benign Het
Peg3 T G 7: 6,708,524 D1233A possibly damaging Het
Pepd C A 7: 34,942,682 T146N probably damaging Het
Ptk2b A T 14: 66,156,392 D877E probably benign Het
Rabgap1l A C 1: 160,443,276 M647R probably damaging Het
Rp1 A G 1: 4,348,784 S702P possibly damaging Het
Shb A T 4: 45,489,161 D238E probably damaging Het
Slc36a1 T A 11: 55,232,508 V433D possibly damaging Het
Spen C T 4: 141,470,370 A3396T probably benign Het
Tcerg1 A T 18: 42,553,494 K705N probably damaging Het
Thbs1 C A 2: 118,113,238 N112K probably benign Het
Zfp658 T C 7: 43,573,495 I398T possibly damaging Het
Other mutations in Heatr5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Heatr5b APN 17 78803434 missense probably damaging 1.00
IGL00418:Heatr5b APN 17 78753141 missense probably damaging 1.00
IGL00786:Heatr5b APN 17 78824634 missense possibly damaging 0.95
IGL00840:Heatr5b APN 17 78765437 missense probably damaging 1.00
IGL01362:Heatr5b APN 17 78816338 splice site probably benign
IGL01419:Heatr5b APN 17 78796510 missense probably benign 0.19
IGL01447:Heatr5b APN 17 78829597 missense probably benign 0.00
IGL01591:Heatr5b APN 17 78808472 missense probably benign 0.01
IGL01743:Heatr5b APN 17 78824640 nonsense probably null
IGL01860:Heatr5b APN 17 78808480 missense probably damaging 0.98
IGL01862:Heatr5b APN 17 78796485 missense possibly damaging 0.96
IGL01984:Heatr5b APN 17 78796497 missense possibly damaging 0.63
IGL02045:Heatr5b APN 17 78808426 missense probably damaging 1.00
IGL02097:Heatr5b APN 17 78817514 missense probably damaging 1.00
IGL02168:Heatr5b APN 17 78831591 unclassified probably benign
IGL02399:Heatr5b APN 17 78827967 missense probably damaging 0.99
IGL02540:Heatr5b APN 17 78773572 missense probably damaging 1.00
IGL02719:Heatr5b APN 17 78815540 missense probably damaging 1.00
IGL02824:Heatr5b APN 17 78773680 missense probably damaging 1.00
IGL02965:Heatr5b APN 17 78753073 missense probably benign 0.37
IGL03032:Heatr5b APN 17 78760499 missense probably benign 0.45
IGL03243:Heatr5b APN 17 78763080 splice site probably benign
IGL03259:Heatr5b APN 17 78791556 missense probably damaging 1.00
IGL03349:Heatr5b APN 17 78755320 missense probably benign 0.01
R5470_heatr5b_501 UTSW 17 78821579 splice site probably null
R0124:Heatr5b UTSW 17 78826217 splice site probably benign
R0285:Heatr5b UTSW 17 78808453 missense probably benign 0.05
R0335:Heatr5b UTSW 17 78827946 missense probably benign 0.15
R0412:Heatr5b UTSW 17 78820854 missense probably benign 0.04
R0601:Heatr5b UTSW 17 78768545 missense probably benign
R0725:Heatr5b UTSW 17 78796396 missense probably benign 0.03
R1178:Heatr5b UTSW 17 78813269 missense probably damaging 1.00
R1444:Heatr5b UTSW 17 78753193 missense probably benign 0.17
R1444:Heatr5b UTSW 17 78755427 splice site probably benign
R1453:Heatr5b UTSW 17 78817563 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1506:Heatr5b UTSW 17 78753147 missense probably damaging 1.00
R1819:Heatr5b UTSW 17 78791511 missense probably damaging 0.98
R1835:Heatr5b UTSW 17 78773563 missense probably damaging 1.00
R1837:Heatr5b UTSW 17 78820751 missense possibly damaging 0.54
R1934:Heatr5b UTSW 17 78795918 missense possibly damaging 0.93
R2014:Heatr5b UTSW 17 78814184 missense probably damaging 1.00
R2037:Heatr5b UTSW 17 78829505 nonsense probably null
R2154:Heatr5b UTSW 17 78831444 missense probably benign 0.00
R2190:Heatr5b UTSW 17 78801756 missense probably damaging 1.00
R2191:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R2413:Heatr5b UTSW 17 78756861 critical splice donor site probably null
R3424:Heatr5b UTSW 17 78768404 missense possibly damaging 0.58
R3607:Heatr5b UTSW 17 78834217 missense probably damaging 1.00
R3759:Heatr5b UTSW 17 78824540 missense possibly damaging 0.94
R3761:Heatr5b UTSW 17 78829642 missense probably damaging 1.00
R4127:Heatr5b UTSW 17 78753174 missense possibly damaging 0.48
R4242:Heatr5b UTSW 17 78756922 missense probably benign 0.00
R4345:Heatr5b UTSW 17 78760511 missense possibly damaging 0.94
R4534:Heatr5b UTSW 17 78810596 missense possibly damaging 0.91
R4623:Heatr5b UTSW 17 78795119 missense possibly damaging 0.52
R4654:Heatr5b UTSW 17 78820701 missense possibly damaging 0.95
R4939:Heatr5b UTSW 17 78762260 missense probably benign 0.18
R4960:Heatr5b UTSW 17 78831584 missense probably benign 0.01
R5037:Heatr5b UTSW 17 78824510 missense probably benign 0.00
R5051:Heatr5b UTSW 17 78795274 missense probably damaging 1.00
R5153:Heatr5b UTSW 17 78795107 nonsense probably null
R5328:Heatr5b UTSW 17 78826362 missense possibly damaging 0.94
R5346:Heatr5b UTSW 17 78827986 missense probably benign 0.44
R5426:Heatr5b UTSW 17 78773713 missense probably damaging 1.00
R5470:Heatr5b UTSW 17 78821579 splice site probably null
R5472:Heatr5b UTSW 17 78801660 missense probably damaging 1.00
R5553:Heatr5b UTSW 17 78753351 splice site probably null
R5706:Heatr5b UTSW 17 78766875 splice site probably null
R5804:Heatr5b UTSW 17 78831522 missense probably damaging 0.97
R5978:Heatr5b UTSW 17 78806036 missense probably damaging 0.99
R6122:Heatr5b UTSW 17 78813173 missense possibly damaging 0.96
R6153:Heatr5b UTSW 17 78831441 missense possibly damaging 0.56
R6220:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R6221:Heatr5b UTSW 17 78766954 missense probably benign 0.05
R6255:Heatr5b UTSW 17 78803434 missense probably damaging 1.00
R6291:Heatr5b UTSW 17 78762097 missense probably benign 0.08
R6455:Heatr5b UTSW 17 78753073 missense probably benign 0.37
R6524:Heatr5b UTSW 17 78814106 missense possibly damaging 0.94
R6575:Heatr5b UTSW 17 78762989 missense probably damaging 1.00
R6899:Heatr5b UTSW 17 78803509 missense probably benign 0.03
R7084:Heatr5b UTSW 17 78810563 missense possibly damaging 0.68
R7138:Heatr5b UTSW 17 78827988 missense probably damaging 1.00
R7148:Heatr5b UTSW 17 78831434 missense probably damaging 0.99
R7382:Heatr5b UTSW 17 78803507 missense possibly damaging 0.64
R7420:Heatr5b UTSW 17 78808480 missense probably damaging 1.00
R7436:Heatr5b UTSW 17 78768533 missense probably benign
R7519:Heatr5b UTSW 17 78755217 missense probably benign
R7606:Heatr5b UTSW 17 78763026 missense probably benign
R7673:Heatr5b UTSW 17 78795983 missense probably damaging 0.97
R7782:Heatr5b UTSW 17 78795941 missense probably damaging 0.99
R7790:Heatr5b UTSW 17 78818823 missense probably damaging 0.99
R7922:Heatr5b UTSW 17 78760559 missense probably benign 0.01
R8184:Heatr5b UTSW 17 78814233 missense probably benign 0.03
R8222:Heatr5b UTSW 17 78801701 missense possibly damaging 0.95
R8276:Heatr5b UTSW 17 78791539 nonsense probably null
R8324:Heatr5b UTSW 17 78755364 missense possibly damaging 0.85
R8430:Heatr5b UTSW 17 78829624 missense probably damaging 0.97
R8432:Heatr5b UTSW 17 78803501 missense probably damaging 0.99
R8781:Heatr5b UTSW 17 78795309 missense probably benign 0.19
R8794:Heatr5b UTSW 17 78815586 missense probably benign 0.00
R8808:Heatr5b UTSW 17 78765405 missense possibly damaging 0.92
R8850:Heatr5b UTSW 17 78801759 missense probably benign 0.02
X0022:Heatr5b UTSW 17 78760545 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- AGATCCGAGAGAATGGCCAC -3'
(R):5'- GGATTGCTCATGGCTTTCAAG -3'

Sequencing Primer
(F):5'- GAGAATGGCCACCGTGG -3'
(R):5'- CTTTCAAGGAGGGGTCATCTAGCC -3'
Posted On2021-03-08