Incidental Mutation 'R8672:Tcerg1'
ID661232
Institutional Source Beutler Lab
Gene Symbol Tcerg1
Ensembl Gene ENSMUSG00000024498
Gene Nametranscription elongation regulator 1 (CA150)
SynonymsTaf2s, 2410022J09Rik, 2900090C16Rik, Fbp28, p144, ca150
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8672 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location42511510-42575551 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42553494 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 705 (K705N)
Ref Sequence ENSEMBL: ENSMUSP00000025375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025375] [ENSMUST00000173642]
PDB Structure FBP28WW DOMAIN FROM MUS MUSCULUS [SOLUTION NMR]
FBP28WW2 domain in complex with the PPLIPPPP peptide [SOLUTION NMR]
FBP28WW2 domain in complex with PTPPPLPP peptide [SOLUTION NMR]
FBP28WW2 domain in complex with a PPPLIPPPP peptide [SOLUTION NMR]
Solution structure of the first WW domain from the mouse transcription elongation regulator 1, transcription factor CA150 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000025375
AA Change: K705N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025375
Gene: ENSMUSG00000024498
AA Change: K705N

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 40 92 N/A INTRINSIC
WW 132 164 8.27e-10 SMART
low complexity region 178 257 N/A INTRINSIC
low complexity region 260 347 N/A INTRINSIC
low complexity region 350 373 N/A INTRINSIC
WW 432 464 2.65e-8 SMART
WW 531 563 1.2e-6 SMART
low complexity region 611 623 N/A INTRINSIC
coiled coil region 629 654 N/A INTRINSIC
FF 661 714 2.67e-13 SMART
FF 727 781 1.51e-12 SMART
FF 794 848 4.29e-17 SMART
FF 898 954 8.33e-15 SMART
FF 956 1012 1.47e-15 SMART
FF 1014 1079 1.3e-16 SMART
Predicted Effect unknown
Transcript: ENSMUST00000173642
AA Change: K705N
SMART Domains Protein: ENSMUSP00000134458
Gene: ENSMUSG00000024498
AA Change: K705N

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 40 92 N/A INTRINSIC
WW 132 164 8.27e-10 SMART
low complexity region 178 257 N/A INTRINSIC
low complexity region 260 347 N/A INTRINSIC
low complexity region 350 373 N/A INTRINSIC
WW 432 464 2.65e-8 SMART
WW 531 563 1.2e-6 SMART
low complexity region 611 623 N/A INTRINSIC
coiled coil region 629 654 N/A INTRINSIC
FF 661 714 2.67e-13 SMART
FF 727 781 1.51e-12 SMART
FF 794 848 4.29e-17 SMART
FF 898 954 8.33e-15 SMART
FF 956 1012 1.47e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that regulates transcriptional elongation and pre-mRNA splicing. The encoded protein interacts with the hyperphosphorylated C-terminal domain of RNA polymerase II via multiple FF domains, and with the pre-mRNA splicing factor SF1 via a WW domain. Alternative splicing results in multiple transcripts variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik G T 17: 48,090,329 E45* probably null Het
4932415D10Rik A T 10: 82,291,892 N1761K probably benign Het
9930021J03Rik T C 19: 29,754,164 T483A probably benign Het
Aadat A T 8: 60,506,145 probably benign Het
Amigo3 A G 9: 108,054,176 H266R possibly damaging Het
Amy2a1 A T 3: 113,529,497 M214K probably damaging Het
Atp11b A T 3: 35,819,917 D685V probably benign Het
Aunip T A 4: 134,523,149 M135K probably benign Het
Card9 T C 2: 26,357,938 T134A probably benign Het
Cd46 G A 1: 195,082,641 T216I probably benign Het
Chit1 T C 1: 134,151,267 V360A unknown Het
Crcp A G 5: 130,042,236 R59G probably benign Het
Csmd1 T A 8: 15,926,598 E2873D probably benign Het
Cyp8b1 T A 9: 121,914,920 M449L probably benign Het
Dpp7 T C 2: 25,356,121 D40G probably benign Het
Eif4g3 T A 4: 138,126,512 L463Q possibly damaging Het
Fzd9 T C 5: 135,249,670 I454V probably benign Het
Gbp11 T A 5: 105,343,809 I41F probably damaging Het
Gkap1 G A 13: 58,243,848 T231I probably damaging Het
Heatr5b A G 17: 78,762,203 L1705P probably damaging Het
Herc3 T A 6: 58,873,801 F467I probably damaging Het
Ifih1 T C 2: 62,605,649 E699G possibly damaging Het
Ints5 T A 19: 8,896,006 L443Q probably damaging Het
Itpr2 A T 6: 146,374,518 C764S probably damaging Het
Kcnma1 A T 14: 23,501,162 I519N probably damaging Het
Krtap4-1 C T 11: 99,628,064 C40Y unknown Het
Mdn1 A G 4: 32,768,793 D5384G probably damaging Het
Mpl T C 4: 118,448,913 Y310C probably damaging Het
Mucl1 A G 15: 103,753,797 S48P possibly damaging Het
Musk T G 4: 58,286,051 probably benign Het
Nemp1 T C 10: 127,677,119 S8P probably benign Het
Nisch A G 14: 31,173,136 C1068R probably damaging Het
Npr3 T C 15: 11,851,493 N404D probably damaging Het
Nwd1 C G 8: 72,667,379 H423Q probably damaging Het
Olfr1062 T A 2: 86,423,632 M15L probably benign Het
Olfr76 C T 19: 12,120,557 V52M probably benign Het
Olfr792 T A 10: 129,540,727 N63K probably damaging Het
Pcdh9 T C 14: 93,887,093 N547S probably benign Het
Pdha2 C A 3: 141,211,363 R128L probably damaging Het
Pebp1 A G 5: 117,283,271 Y181H probably benign Het
Peg3 T G 7: 6,708,524 D1233A possibly damaging Het
Pepd C A 7: 34,942,682 T146N probably damaging Het
Ptk2b A T 14: 66,156,392 D877E probably benign Het
Rabgap1l A C 1: 160,443,276 M647R probably damaging Het
Rp1 A G 1: 4,348,784 S702P possibly damaging Het
Shb A T 4: 45,489,161 D238E probably damaging Het
Slc36a1 T A 11: 55,232,508 V433D possibly damaging Het
Spen C T 4: 141,470,370 A3396T probably benign Het
Thbs1 C A 2: 118,113,238 N112K probably benign Het
Zfp658 T C 7: 43,573,495 I398T possibly damaging Het
Other mutations in Tcerg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00701:Tcerg1 APN 18 42536342 missense probably benign 0.34
IGL00708:Tcerg1 APN 18 42571125 missense probably benign 0.38
IGL00741:Tcerg1 APN 18 42568453 missense possibly damaging 0.94
IGL01314:Tcerg1 APN 18 42573309 missense probably damaging 1.00
IGL01358:Tcerg1 APN 18 42524277 missense unknown
IGL01832:Tcerg1 APN 18 42574555 missense probably damaging 0.99
IGL01985:Tcerg1 APN 18 42530656 missense unknown
IGL02937:Tcerg1 APN 18 42524349 missense unknown
IGL02953:Tcerg1 APN 18 42548470 missense probably damaging 1.00
IGL03082:Tcerg1 APN 18 42573357 missense probably damaging 1.00
P0031:Tcerg1 UTSW 18 42573302 missense probably benign 0.07
R0060:Tcerg1 UTSW 18 42524008 missense unknown
R0138:Tcerg1 UTSW 18 42568614 splice site probably benign
R0482:Tcerg1 UTSW 18 42564240 splice site probably benign
R0502:Tcerg1 UTSW 18 42522956 missense unknown
R0731:Tcerg1 UTSW 18 42571840 missense probably damaging 0.99
R1117:Tcerg1 UTSW 18 42574652 missense probably damaging 0.99
R1542:Tcerg1 UTSW 18 42553430 missense probably damaging 0.99
R1571:Tcerg1 UTSW 18 42524292 missense unknown
R1673:Tcerg1 UTSW 18 42552581 missense possibly damaging 0.91
R1678:Tcerg1 UTSW 18 42524349 missense unknown
R1799:Tcerg1 UTSW 18 42560947 missense possibly damaging 0.92
R2094:Tcerg1 UTSW 18 42564145 missense possibly damaging 0.92
R2231:Tcerg1 UTSW 18 42524244 missense unknown
R2989:Tcerg1 UTSW 18 42519475 missense unknown
R3831:Tcerg1 UTSW 18 42568489 missense probably damaging 1.00
R4009:Tcerg1 UTSW 18 42564136 frame shift probably null
R4034:Tcerg1 UTSW 18 42519533 missense unknown
R4826:Tcerg1 UTSW 18 42535115 missense unknown
R4858:Tcerg1 UTSW 18 42523981 missense unknown
R5371:Tcerg1 UTSW 18 42519535 missense unknown
R5865:Tcerg1 UTSW 18 42536348 missense probably damaging 0.98
R6128:Tcerg1 UTSW 18 42511498 splice site probably null
R6258:Tcerg1 UTSW 18 42553465 missense probably damaging 1.00
R6260:Tcerg1 UTSW 18 42553465 missense probably damaging 1.00
R6516:Tcerg1 UTSW 18 42530892 critical splice donor site probably null
R6825:Tcerg1 UTSW 18 42548477 missense probably damaging 0.98
R7147:Tcerg1 UTSW 18 42550063 missense probably benign 0.22
R7714:Tcerg1 UTSW 18 42560935 missense possibly damaging 0.77
R7739:Tcerg1 UTSW 18 42523974 missense unknown
R7838:Tcerg1 UTSW 18 42536937 missense probably benign 0.01
R8204:Tcerg1 UTSW 18 42574553 missense probably damaging 1.00
R8293:Tcerg1 UTSW 18 42560955 missense probably benign 0.03
R8300:Tcerg1 UTSW 18 42550072 missense probably benign 0.22
R8426:Tcerg1 UTSW 18 42548401 missense possibly damaging 0.68
R8514:Tcerg1 UTSW 18 42564122 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAATTTGCTGTTGCTAGCCTC -3'
(R):5'- CAAAACATCGCGACAGTGG -3'

Sequencing Primer
(F):5'- ATGTCTCCTTTACAAACAGATGCC -3'
(R):5'- ACATCGCGACAGTGGCTTAGTC -3'
Posted On2021-03-08