Incidental Mutation 'R8673:Chchd6'
ID 661256
Institutional Source Beutler Lab
Gene Symbol Chchd6
Ensembl Gene ENSMUSG00000030086
Gene Name coiled-coil-helix-coiled-coil-helix domain containing 6
Synonyms 1700021B03Rik, 0710001P09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R8673 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 89383146-89595652 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 89569398 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 109 (S109C)
Ref Sequence ENSEMBL: ENSMUSP00000032172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032172] [ENSMUST00000113550]
AlphaFold Q91VN4
Predicted Effect probably damaging
Transcript: ENSMUST00000032172
AA Change: S109C

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032172
Gene: ENSMUSG00000030086
AA Change: S109C

DomainStartEndE-ValueType
Pfam:DUF737 16 227 1.5e-55 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113550
AA Change: S109C

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109179
Gene: ENSMUSG00000030086
AA Change: S109C

DomainStartEndE-ValueType
Pfam:DUF737 16 179 4.8e-47 PFAM
Pfam:DUF737 173 199 9.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204654
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik G T 17: 48,090,329 E45* probably null Het
5430419D17Rik A T 7: 131,243,117 I580F probably damaging Het
Anxa9 C T 3: 95,300,346 R250Q probably benign Het
Apaf1 A G 10: 90,995,668 S1195P probably damaging Het
Baiap2l1 T A 5: 144,276,042 probably benign Het
Bpifb6 G T 2: 153,905,292 C172F probably damaging Het
Ccdc9 A T 7: 16,284,361 D7E probably damaging Het
Cltc G A 11: 86,757,375 probably benign Het
Col4a6 G A X: 141,234,177 P60L probably damaging Het
Cxxc1 C T 18: 74,218,844 T264I probably benign Het
D5Ertd579e A G 5: 36,672,807 S58P probably benign Het
Dlgap1 T A 17: 70,815,298 H907Q probably damaging Het
Dnah2 A T 11: 69,514,697 M663K probably benign Het
Dock8 G A 19: 25,183,503 M1791I probably damaging Het
Esd T C 14: 74,732,512 F8S probably benign Het
Etnk2 T C 1: 133,374,562 Y273H probably damaging Het
Fry C A 5: 150,395,111 H935Q possibly damaging Het
Gabrr3 T G 16: 59,415,270 M45R possibly damaging Het
Gata4 T C 14: 63,240,809 T114A probably benign Het
Gcnt4 G A 13: 96,946,489 D98N probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igkv1-99 C T 6: 68,542,403 Q115* probably null Het
Irak3 G T 10: 120,146,588 T323K possibly damaging Het
Lrp2 T C 2: 69,472,460 D2975G probably damaging Het
Mybph T A 1: 134,198,404 W319R probably damaging Het
Nell1 A G 7: 50,219,595 D206G probably damaging Het
Olfr1117-ps1 A T 2: 87,284,314 D8V probably benign Het
Olfr1202 T C 2: 88,817,246 V25A probably benign Het
Olfr1468-ps1 T C 19: 13,375,217 I85T probably benign Het
Pex1 A C 5: 3,635,886 D1209A possibly damaging Het
Phf10 T C 17: 14,950,606 D355G probably benign Het
Psmd2 T C 16: 20,656,888 S413P probably damaging Het
Ptgir G T 7: 16,907,362 C193F probably damaging Het
Rad21l A G 2: 151,660,798 I164T possibly damaging Het
Ralgapb G A 2: 158,450,213 R773H probably damaging Het
Rasgef1b G T 5: 99,222,985 N385K probably damaging Het
Shank3 C T 15: 89,549,776 R1575C probably damaging Het
Slc7a2 G T 8: 40,912,409 probably benign Het
Spata1 T A 3: 146,475,324 N293I probably damaging Het
Spen C T 4: 141,470,370 A3396T probably benign Het
Sphkap T C 1: 83,275,840 H1396R probably benign Het
Spire2 A G 8: 123,360,128 E446G probably damaging Het
Tdpoz2 A T 3: 93,651,611 C351* probably null Het
Thoc5 G A 11: 4,926,061 V605I possibly damaging Het
Ttll2 C T 17: 7,351,941 V196I possibly damaging Het
Uba6 A G 5: 86,136,319 Y576H probably damaging Het
Vegfb G A 19: 6,985,444 P188L unknown Het
Vmn1r62 A G 7: 5,675,278 probably benign Het
Vmn2r73 T A 7: 85,872,694 T146S probably benign Het
Wdr64 A G 1: 175,806,018 Y945C probably damaging Het
Zfp870 C T 17: 32,882,930 C475Y probably damaging Het
Zfp958 A T 8: 4,628,268 T98S possibly damaging Het
Other mutations in Chchd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Chchd6 APN 6 89569417 splice site probably null
IGL02340:Chchd6 APN 6 89419780 missense probably damaging 0.99
IGL02490:Chchd6 APN 6 89384674 missense possibly damaging 0.90
R0557:Chchd6 UTSW 6 89574587 missense probably damaging 1.00
R1170:Chchd6 UTSW 6 89384687 missense probably damaging 1.00
R1341:Chchd6 UTSW 6 89384641 missense probably benign 0.00
R1619:Chchd6 UTSW 6 89419754 missense possibly damaging 0.95
R1757:Chchd6 UTSW 6 89384644 missense probably damaging 1.00
R3886:Chchd6 UTSW 6 89467451 missense probably damaging 1.00
R4627:Chchd6 UTSW 6 89384660 missense probably damaging 1.00
R4635:Chchd6 UTSW 6 89467466 missense probably damaging 1.00
R5518:Chchd6 UTSW 6 89567585 critical splice donor site probably null
R6732:Chchd6 UTSW 6 89574454 missense probably benign 0.03
R6869:Chchd6 UTSW 6 89595496 missense probably damaging 1.00
R9365:Chchd6 UTSW 6 89574431 missense probably benign 0.25
R9502:Chchd6 UTSW 6 89419781 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAACATGAGGCATTGTGCTCC -3'
(R):5'- GAGGTTATGCTCCTATCTGCC -3'

Sequencing Primer
(F):5'- AGGCATTGTGCTCCAGGGAG -3'
(R):5'- AGAACTCTGCAGTCTGTCCATGG -3'
Posted On 2021-03-08