Incidental Mutation 'R0238:Dock4'
Institutional Source Beutler Lab
Gene Symbol Dock4
Ensembl Gene ENSMUSG00000035954
Gene Namededicator of cytokinesis 4
SynonymsEST N28122, 6330411N01Rik
MMRRC Submission 038476-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock #R0238 (G1)
Quality Score225
Status Not validated
Chromosomal Location40445952-40846874 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 40737540 bp
Amino Acid Change Serine to Isoleucine at position 818 (S818I)
Ref Sequence ENSEMBL: ENSMUSP00000152420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037488] [ENSMUST00000220912]
Predicted Effect probably benign
Transcript: ENSMUST00000037488
AA Change: S818I

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000047387
Gene: ENSMUSG00000035954
AA Change: S818I

SH3 9 66 7.29e-10 SMART
Pfam:DOCK_N 69 392 8.2e-110 PFAM
Pfam:DOCK-C2 397 583 1.9e-55 PFAM
low complexity region 829 842 N/A INTRINSIC
Pfam:DHR-2 1092 1596 5e-108 PFAM
low complexity region 1651 1664 N/A INTRINSIC
low complexity region 1681 1696 N/A INTRINSIC
low complexity region 1700 1713 N/A INTRINSIC
low complexity region 1842 1872 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1940 1950 N/A INTRINSIC
low complexity region 1958 1973 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220912
AA Change: S818I

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222287
Meta Mutation Damage Score 0.4868 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 92.6%
  • 20x: 76.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the dedicator of cytokinesis (DOCK) family and encodes a protein with a DHR-1 (CZH-1) domain, a DHR-2 (CZH-2) domain and an SH3 domain. This membrane-associated, cytoplasmic protein functions as a guanine nucleotide exchange factor and is involved in regulation of adherens junctions between cells. Mutations in this gene have been associated with ovarian, prostate, glioma, and colorectal cancers. Alternatively spliced variants which encode different protein isoforms have been described, but only one has been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality. Heterozygotes display altered blood vessel lumen formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aar2 T G 2: 156,550,973 V94G probably benign Het
Acp5 A T 9: 22,129,922 S70T possibly damaging Het
Adcy1 C G 11: 7,139,162 N525K possibly damaging Het
AI464131 A T 4: 41,498,912 N239K probably benign Het
Aknad1 A G 3: 108,781,239 M628V probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Cacna1d A G 14: 30,123,496 V572A probably benign Het
Ccdc158 A C 5: 92,662,118 M177R probably benign Het
Ccdc191 A T 16: 43,947,496 R678* probably null Het
Cdkn2d C A 9: 21,290,992 probably benign Het
Cdx2 G T 5: 147,303,287 T193K probably damaging Het
Cfap44 T A 16: 44,422,318 M695K probably benign Het
Cfap70 A C 14: 20,448,605 S5A probably benign Het
Chd9 T C 8: 90,932,828 S139P probably damaging Het
Chmp7 A G 14: 69,720,997 V241A probably damaging Het
Cnga1 A G 5: 72,605,031 I380T probably damaging Het
Cts6 T A 13: 61,201,819 E53D probably damaging Het
Dclk3 A T 9: 111,482,628 N646I probably damaging Het
Dnhd1 A G 7: 105,721,531 S4673G probably benign Het
Dysf C T 6: 84,064,479 Q156* probably null Het
Fam163b T C 2: 27,112,634 N117S probably damaging Het
Fam89a A G 8: 124,741,232 Y114H probably damaging Het
Flcn T C 11: 59,801,076 N249S probably benign Het
Gm20422 T C 8: 69,766,715 Y53C probably damaging Het
Gnai1 A G 5: 18,273,550 S206P probably damaging Het
Hal T C 10: 93,503,482 S478P possibly damaging Het
Haus3 G A 5: 34,166,256 P337S possibly damaging Het
Hectd1 T A 12: 51,769,318 M1324L possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Hspa9 A T 18: 34,946,646 Y243* probably null Het
Htr3a T C 9: 48,906,386 T96A probably benign Het
Ift140 C A 17: 25,045,523 C557* probably null Het
Jph3 A G 8: 121,753,720 Q379R possibly damaging Het
Kcnb1 A G 2: 167,104,969 V653A probably benign Het
Kif14 A G 1: 136,527,393 E1551G probably damaging Het
Krt17 G A 11: 100,260,878 R30* probably null Het
Lamb3 A T 1: 193,321,053 D100V probably damaging Het
Map2 A G 1: 66,416,106 D1385G probably damaging Het
Map3k21 A G 8: 125,944,970 D999G possibly damaging Het
Marf1 T C 16: 14,151,283 I109V probably benign Het
Mcam T G 9: 44,140,205 probably null Het
Med18 T C 4: 132,460,026 H99R probably damaging Het
Mettl25 C T 10: 105,826,525 V195I probably damaging Het
Myh8 A G 11: 67,301,692 T1466A probably benign Het
Myo1e A T 9: 70,342,126 I503F possibly damaging Het
Myo3b T A 2: 70,105,425 C61S probably benign Het
Nf1 A T 11: 79,418,574 K438M possibly damaging Het
Nlrp9c A G 7: 26,378,012 S727P possibly damaging Het
Nmbr C T 10: 14,770,395 Q338* probably null Het
Nt5e A G 9: 88,367,332 S440G possibly damaging Het
Nubp2 T C 17: 24,884,471 E144G probably damaging Het
Olfr1126 T C 2: 87,458,037 F291L probably benign Het
Olfr593 G A 7: 103,212,726 V289M possibly damaging Het
Olfr694 A G 7: 106,689,255 Y159H probably benign Het
Otogl T A 10: 107,806,696 N1291I probably damaging Het
Pa2g4 T C 10: 128,563,642 K51R probably benign Het
Pcdhb12 A G 18: 37,436,727 I309V probably benign Het
Pck1 T G 2: 173,157,068 I373S possibly damaging Het
Pga5 A G 19: 10,669,453 Y305H probably damaging Het
Plxnd1 G T 6: 115,968,793 D906E probably benign Het
Ppfia4 T C 1: 134,329,189 E98G possibly damaging Het
Rab39 G A 9: 53,706,030 T29I probably damaging Het
Raet1e C A 10: 22,180,862 H112Q possibly damaging Het
Rars2 T C 4: 34,645,838 Y252H probably damaging Het
Rars2 A C 4: 34,656,030 Q421P probably benign Het
Rasa2 A T 9: 96,568,407 D479E probably damaging Het
Rbl2 A T 8: 91,106,507 T689S probably damaging Het
Rims4 C T 2: 163,864,025 V230M probably benign Het
Skp2 A C 15: 9,127,884 probably null Het
Slc35f4 A T 14: 49,304,256 I347N possibly damaging Het
Slc4a2 A T 5: 24,436,274 probably null Het
Slc52a3 T C 2: 152,008,156 *461Q probably null Het
Slc6a1 G A 6: 114,302,800 V142I probably benign Het
Susd5 A G 9: 114,096,909 *620W probably null Het
Timm21 T C 18: 84,947,666 N239S probably damaging Het
Tmem63c T C 12: 87,075,639 W404R probably damaging Het
Tnrc6b A G 15: 80,887,864 D1118G probably damaging Het
Traf2 G C 2: 25,537,126 A71G possibly damaging Het
Trim54 A G 5: 31,134,119 M195V probably benign Het
Trip11 C T 12: 101,884,728 E741K probably damaging Het
Trp73 AGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTG 4: 154,062,524 probably benign Het
Trpm5 G T 7: 143,082,958 T414N probably damaging Het
Vps51 G T 19: 6,071,437 S185* probably null Het
Zfp329 G T 7: 12,810,829 T256K probably damaging Het
Zfp729b A G 13: 67,591,903 Y748H probably damaging Het
Zfp777 T C 6: 48,024,969 E773G probably damaging Het
Other mutations in Dock4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Dock4 APN 12 40832306 missense possibly damaging 0.48
IGL00726:Dock4 APN 12 40790068 splice site probably benign
IGL00790:Dock4 APN 12 40834391 missense probably damaging 1.00
IGL01061:Dock4 APN 12 40702969 missense probably benign 0.01
IGL01083:Dock4 APN 12 40788381 splice site probably benign
IGL01412:Dock4 APN 12 40730041 splice site probably benign
IGL01583:Dock4 APN 12 40810467 nonsense probably null
IGL01603:Dock4 APN 12 40693031 missense probably damaging 1.00
IGL01766:Dock4 APN 12 40446379 nonsense probably null
IGL02067:Dock4 APN 12 40834385 missense probably damaging 1.00
IGL02302:Dock4 APN 12 40725777 missense probably damaging 1.00
IGL02406:Dock4 APN 12 40777207 missense probably benign 0.01
IGL02547:Dock4 APN 12 40737479 missense probably benign
IGL02613:Dock4 APN 12 40810466 missense probably damaging 1.00
IGL02643:Dock4 APN 12 40668430 missense probably damaging 1.00
IGL02952:Dock4 APN 12 40710903 critical splice donor site probably null
IGL02994:Dock4 APN 12 40779160 missense probably damaging 0.99
IGL03096:Dock4 APN 12 40748001 missense probably benign 0.00
IGL03144:Dock4 APN 12 40692907 splice site probably benign
IGL03223:Dock4 APN 12 40817594 missense probably damaging 1.00
IGL03296:Dock4 APN 12 40733257 missense possibly damaging 0.84
IGL03349:Dock4 APN 12 40733310 missense probably benign 0.42
IGL03353:Dock4 APN 12 40817758 splice site probably null
BB005:Dock4 UTSW 12 40788303 missense probably damaging 0.98
BB015:Dock4 UTSW 12 40788303 missense probably damaging 0.98
R0046:Dock4 UTSW 12 40737360 splice site probably benign
R0046:Dock4 UTSW 12 40737360 splice site probably benign
R0110:Dock4 UTSW 12 40621312 splice site probably benign
R0238:Dock4 UTSW 12 40737540 missense probably damaging 0.98
R0239:Dock4 UTSW 12 40737540 missense probably damaging 0.98
R0239:Dock4 UTSW 12 40737540 missense probably damaging 0.98
R0472:Dock4 UTSW 12 40838438 intron probably benign
R0616:Dock4 UTSW 12 40704415 missense probably benign 0.31
R0647:Dock4 UTSW 12 40710884 missense probably damaging 1.00
R0706:Dock4 UTSW 12 40702923 missense probably damaging 0.98
R0791:Dock4 UTSW 12 40704481 missense probably damaging 1.00
R0940:Dock4 UTSW 12 40631627 splice site probably benign
R1087:Dock4 UTSW 12 40729938 missense probably benign 0.40
R1180:Dock4 UTSW 12 40640414 missense possibly damaging 0.52
R1194:Dock4 UTSW 12 40829616 missense probably damaging 1.00
R1463:Dock4 UTSW 12 40816325 frame shift probably null
R1468:Dock4 UTSW 12 40755810 missense probably benign 0.00
R1468:Dock4 UTSW 12 40755810 missense probably benign 0.00
R1523:Dock4 UTSW 12 40693025 missense possibly damaging 0.88
R1616:Dock4 UTSW 12 40669045 missense probably damaging 0.99
R1682:Dock4 UTSW 12 40725780 missense probably damaging 1.00
R1691:Dock4 UTSW 12 40725755 missense probably benign 0.26
R1693:Dock4 UTSW 12 40834722 missense probably benign 0.07
R1737:Dock4 UTSW 12 40807001 splice site probably null
R1802:Dock4 UTSW 12 40794598 missense possibly damaging 0.90
R1813:Dock4 UTSW 12 40636228 missense probably damaging 1.00
R1846:Dock4 UTSW 12 40733268 missense probably benign 0.00
R1959:Dock4 UTSW 12 40710798 missense probably damaging 1.00
R1975:Dock4 UTSW 12 40779642 splice site probably benign
R1986:Dock4 UTSW 12 40730063 missense probably damaging 1.00
R2105:Dock4 UTSW 12 40692989 missense probably benign 0.00
R2134:Dock4 UTSW 12 40745668 missense probably benign
R2135:Dock4 UTSW 12 40745668 missense probably benign
R2154:Dock4 UTSW 12 40820662 missense probably damaging 1.00
R2154:Dock4 UTSW 12 40844548 small insertion probably benign
R2864:Dock4 UTSW 12 40730073 missense probably damaging 1.00
R2890:Dock4 UTSW 12 40623801 critical splice acceptor site probably null
R3086:Dock4 UTSW 12 40731863 missense probably benign 0.02
R3808:Dock4 UTSW 12 40672810 missense probably damaging 0.99
R3811:Dock4 UTSW 12 40779124 missense possibly damaging 0.87
R3836:Dock4 UTSW 12 40794624 critical splice donor site probably null
R3838:Dock4 UTSW 12 40794624 critical splice donor site probably null
R4091:Dock4 UTSW 12 40844267 missense probably damaging 0.99
R4735:Dock4 UTSW 12 40631526 missense probably benign 0.31
R4752:Dock4 UTSW 12 40446365 missense probably benign 0.04
R4828:Dock4 UTSW 12 40668437 missense probably damaging 1.00
R5039:Dock4 UTSW 12 40817746 missense probably damaging 1.00
R5092:Dock4 UTSW 12 40844441 missense probably benign
R5146:Dock4 UTSW 12 40649492 splice site probably null
R5213:Dock4 UTSW 12 40676742 missense probably damaging 1.00
R5214:Dock4 UTSW 12 40704466 missense probably benign 0.00
R5270:Dock4 UTSW 12 40733271 missense probably benign 0.02
R5426:Dock4 UTSW 12 40745745 missense probably damaging 1.00
R5474:Dock4 UTSW 12 40745731 missense probably benign
R5544:Dock4 UTSW 12 40834702 missense possibly damaging 0.87
R5615:Dock4 UTSW 12 40649480 missense probably benign 0.22
R5649:Dock4 UTSW 12 40844540 missense probably benign 0.03
R5702:Dock4 UTSW 12 40737491 missense probably benign 0.02
R5846:Dock4 UTSW 12 40817736 missense probably damaging 1.00
R5847:Dock4 UTSW 12 40621251 missense probably damaging 0.97
R5895:Dock4 UTSW 12 40755813 missense probably damaging 1.00
R5997:Dock4 UTSW 12 40755834 missense probably damaging 0.99
R6011:Dock4 UTSW 12 40817757 critical splice donor site probably null
R6022:Dock4 UTSW 12 40748110 missense probably benign 0.04
R6038:Dock4 UTSW 12 40733351 splice site probably null
R6038:Dock4 UTSW 12 40733351 splice site probably null
R6179:Dock4 UTSW 12 40731869 missense probably benign 0.00
R6479:Dock4 UTSW 12 40828955 missense probably damaging 1.00
R6516:Dock4 UTSW 12 40731899 missense possibly damaging 0.94
R6748:Dock4 UTSW 12 40704466 missense probably benign 0.44
R6752:Dock4 UTSW 12 40820617 missense probably damaging 1.00
R6814:Dock4 UTSW 12 40812326 critical splice donor site probably null
R6864:Dock4 UTSW 12 40745746 missense probably damaging 1.00
R6872:Dock4 UTSW 12 40812326 critical splice donor site probably null
R6891:Dock4 UTSW 12 40779136 missense probably damaging 1.00
R6937:Dock4 UTSW 12 40834635 missense probably benign 0.01
R6950:Dock4 UTSW 12 40733314 missense possibly damaging 0.80
R7081:Dock4 UTSW 12 40621286 missense probably damaging 1.00
R7129:Dock4 UTSW 12 40828879 missense probably damaging 1.00
R7140:Dock4 UTSW 12 40636159 missense probably benign 0.06
R7241:Dock4 UTSW 12 40794860 missense probably damaging 1.00
R7378:Dock4 UTSW 12 40788244 missense possibly damaging 0.94
R7714:Dock4 UTSW 12 40725649 nonsense probably null
R7720:Dock4 UTSW 12 40806975 missense probably damaging 0.99
R7756:Dock4 UTSW 12 40710879 missense probably benign 0.02
R7758:Dock4 UTSW 12 40710879 missense probably benign 0.02
R7759:Dock4 UTSW 12 40817736 missense probably damaging 1.00
R7787:Dock4 UTSW 12 40725677 missense probably benign
R7879:Dock4 UTSW 12 40730084 missense possibly damaging 0.76
R7928:Dock4 UTSW 12 40788303 missense probably damaging 0.98
R8000:Dock4 UTSW 12 40833119 missense probably benign 0.05
R8042:Dock4 UTSW 12 40745760 missense probably benign 0.01
R8231:Dock4 UTSW 12 40702951 missense possibly damaging 0.88
R8234:Dock4 UTSW 12 40834838 splice site probably null
RF018:Dock4 UTSW 12 40844399 frame shift probably null
RF025:Dock4 UTSW 12 40844393 frame shift probably null
RF063:Dock4 UTSW 12 40844399 frame shift probably null
X0028:Dock4 UTSW 12 40669047 missense probably benign 0.25
Z1176:Dock4 UTSW 12 40631614 missense probably benign 0.01
Z1176:Dock4 UTSW 12 40631616 missense probably benign 0.16
Z1177:Dock4 UTSW 12 40817641 missense possibly damaging 0.88
Predicted Primers
Posted On2013-08-19