Incidental Mutation 'R0238:Hist1h1t'
ID66136
Institutional Source Beutler Lab
Gene Symbol Hist1h1t
Ensembl Gene ENSMUSG00000036211
Gene Namehistone cluster 1, H1t
SynonymsH1ft
MMRRC Submission 038476-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0238 (G1)
Quality Score204
Status Not validated
Chromosome13
Chromosomal Location23695814-23696725 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 23696324 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 153 (K153N)
Ref Sequence ENSEMBL: ENSMUSP00000037304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018246] [ENSMUST00000041052] [ENSMUST00000102967]
Predicted Effect probably benign
Transcript: ENSMUST00000018246
SMART Domains Protein: ENSMUSP00000018246
Gene: ENSMUSG00000018102

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 1.43e-72 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000041052
AA Change: K153N

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037304
Gene: ENSMUSG00000036211
AA Change: K153N

DomainStartEndE-ValueType
H15 37 102 5.15e-21 SMART
low complexity region 111 135 N/A INTRINSIC
low complexity region 142 161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102967
SMART Domains Protein: ENSMUSP00000100032
Gene: ENSMUSG00000060678

DomainStartEndE-ValueType
H4 16 90 2.59e-29 SMART
Meta Mutation Damage Score 0.1509 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 92.6%
  • 20x: 76.9%
Validation Efficiency
MGI Phenotype FUNCTION: Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H1 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice develop normally and exhibit normal testicular morphology, spermatogenesis and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aar2 T G 2: 156,550,973 V94G probably benign Het
Acp5 A T 9: 22,129,922 S70T possibly damaging Het
Adcy1 C G 11: 7,139,162 N525K possibly damaging Het
AI464131 A T 4: 41,498,912 N239K probably benign Het
Aknad1 A G 3: 108,781,239 M628V probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Cacna1d A G 14: 30,123,496 V572A probably benign Het
Ccdc158 A C 5: 92,662,118 M177R probably benign Het
Ccdc191 A T 16: 43,947,496 R678* probably null Het
Cdkn2d C A 9: 21,290,992 probably benign Het
Cdx2 G T 5: 147,303,287 T193K probably damaging Het
Cfap44 T A 16: 44,422,318 M695K probably benign Het
Cfap70 A C 14: 20,448,605 S5A probably benign Het
Chd9 T C 8: 90,932,828 S139P probably damaging Het
Chmp7 A G 14: 69,720,997 V241A probably damaging Het
Cnga1 A G 5: 72,605,031 I380T probably damaging Het
Cts6 T A 13: 61,201,819 E53D probably damaging Het
Dclk3 A T 9: 111,482,628 N646I probably damaging Het
Dnhd1 A G 7: 105,721,531 S4673G probably benign Het
Dock4 G T 12: 40,737,540 S818I probably damaging Het
Dysf C T 6: 84,064,479 Q156* probably null Het
Fam163b T C 2: 27,112,634 N117S probably damaging Het
Fam89a A G 8: 124,741,232 Y114H probably damaging Het
Flcn T C 11: 59,801,076 N249S probably benign Het
Gm20422 T C 8: 69,766,715 Y53C probably damaging Het
Gnai1 A G 5: 18,273,550 S206P probably damaging Het
Hal T C 10: 93,503,482 S478P possibly damaging Het
Haus3 G A 5: 34,166,256 P337S possibly damaging Het
Hectd1 T A 12: 51,769,318 M1324L possibly damaging Het
Hspa9 A T 18: 34,946,646 Y243* probably null Het
Htr3a T C 9: 48,906,386 T96A probably benign Het
Ift140 C A 17: 25,045,523 C557* probably null Het
Jph3 A G 8: 121,753,720 Q379R possibly damaging Het
Kcnb1 A G 2: 167,104,969 V653A probably benign Het
Kif14 A G 1: 136,527,393 E1551G probably damaging Het
Krt17 G A 11: 100,260,878 R30* probably null Het
Lamb3 A T 1: 193,321,053 D100V probably damaging Het
Map2 A G 1: 66,416,106 D1385G probably damaging Het
Map3k21 A G 8: 125,944,970 D999G possibly damaging Het
Marf1 T C 16: 14,151,283 I109V probably benign Het
Mcam T G 9: 44,140,205 probably null Het
Med18 T C 4: 132,460,026 H99R probably damaging Het
Mettl25 C T 10: 105,826,525 V195I probably damaging Het
Myh8 A G 11: 67,301,692 T1466A probably benign Het
Myo1e A T 9: 70,342,126 I503F possibly damaging Het
Myo3b T A 2: 70,105,425 C61S probably benign Het
Nf1 A T 11: 79,418,574 K438M possibly damaging Het
Nlrp9c A G 7: 26,378,012 S727P possibly damaging Het
Nmbr C T 10: 14,770,395 Q338* probably null Het
Nt5e A G 9: 88,367,332 S440G possibly damaging Het
Nubp2 T C 17: 24,884,471 E144G probably damaging Het
Olfr1126 T C 2: 87,458,037 F291L probably benign Het
Olfr593 G A 7: 103,212,726 V289M possibly damaging Het
Olfr694 A G 7: 106,689,255 Y159H probably benign Het
Otogl T A 10: 107,806,696 N1291I probably damaging Het
Pa2g4 T C 10: 128,563,642 K51R probably benign Het
Pcdhb12 A G 18: 37,436,727 I309V probably benign Het
Pck1 T G 2: 173,157,068 I373S possibly damaging Het
Pga5 A G 19: 10,669,453 Y305H probably damaging Het
Plxnd1 G T 6: 115,968,793 D906E probably benign Het
Ppfia4 T C 1: 134,329,189 E98G possibly damaging Het
Rab39 G A 9: 53,706,030 T29I probably damaging Het
Raet1e C A 10: 22,180,862 H112Q possibly damaging Het
Rars2 T C 4: 34,645,838 Y252H probably damaging Het
Rars2 A C 4: 34,656,030 Q421P probably benign Het
Rasa2 A T 9: 96,568,407 D479E probably damaging Het
Rbl2 A T 8: 91,106,507 T689S probably damaging Het
Rims4 C T 2: 163,864,025 V230M probably benign Het
Skp2 A C 15: 9,127,884 probably null Het
Slc35f4 A T 14: 49,304,256 I347N possibly damaging Het
Slc4a2 A T 5: 24,436,274 probably null Het
Slc52a3 T C 2: 152,008,156 *461Q probably null Het
Slc6a1 G A 6: 114,302,800 V142I probably benign Het
Susd5 A G 9: 114,096,909 *620W probably null Het
Timm21 T C 18: 84,947,666 N239S probably damaging Het
Tmem63c T C 12: 87,075,639 W404R probably damaging Het
Tnrc6b A G 15: 80,887,864 D1118G probably damaging Het
Traf2 G C 2: 25,537,126 A71G possibly damaging Het
Trim54 A G 5: 31,134,119 M195V probably benign Het
Trip11 C T 12: 101,884,728 E741K probably damaging Het
Trp73 AGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTG 4: 154,062,524 probably benign Het
Trpm5 G T 7: 143,082,958 T414N probably damaging Het
Vps51 G T 19: 6,071,437 S185* probably null Het
Zfp329 G T 7: 12,810,829 T256K probably damaging Het
Zfp729b A G 13: 67,591,903 Y748H probably damaging Het
Zfp777 T C 6: 48,024,969 E773G probably damaging Het
Other mutations in Hist1h1t
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Hist1h1t APN 13 23696049 missense probably damaging 0.98
FR4304:Hist1h1t UTSW 13 23695920 unclassified probably benign
FR4342:Hist1h1t UTSW 13 23695913 unclassified probably benign
FR4548:Hist1h1t UTSW 13 23695920 unclassified probably benign
R0167:Hist1h1t UTSW 13 23695903 missense probably benign 0.02
R0238:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R0564:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R0726:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R0827:Hist1h1t UTSW 13 23696221 missense probably benign 0.01
R0972:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R1128:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R1129:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R1130:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R5652:Hist1h1t UTSW 13 23696236 missense probably benign 0.01
R5827:Hist1h1t UTSW 13 23696202 missense possibly damaging 0.91
R6538:Hist1h1t UTSW 13 23695921 missense probably benign 0.06
R7729:Hist1h1t UTSW 13 23696472 missense possibly damaging 0.93
R7774:Hist1h1t UTSW 13 23696200 missense possibly damaging 0.91
Predicted Primers
Posted On2013-08-19