Incidental Mutation 'R8676:Gm436'
ID 661373
Institutional Source Beutler Lab
Gene Symbol Gm436
Ensembl Gene ENSMUSG00000078505
Gene Name predicted gene 436
Synonyms LOC230890
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock # R8676 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 144669937-144686368 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 144670113 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 350 (R350C)
Ref Sequence ENSEMBL: ENSMUSP00000101373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105747]
AlphaFold B1AVU6
Predicted Effect possibly damaging
Transcript: ENSMUST00000105747
AA Change: R350C

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101373
Gene: ENSMUSG00000078505
AA Change: R350C

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Abhydrolase_3 115 285 1.6e-29 PFAM
Pfam:Abhydrolase_3 292 381 9e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 93% (54/58)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik A G 4: 107,895,599 N152D unknown Het
1700021F05Rik A G 10: 43,532,937 L70S probably benign Het
Acsm3 T A 7: 119,775,169 S281R probably damaging Het
Adipor2 G T 6: 119,363,486 probably benign Het
Alk T C 17: 71,897,941 S1079G probably damaging Het
Ankrd27 T C 7: 35,602,584 probably null Het
Anxa6 C A 11: 55,001,282 E283* probably null Het
Bnc2 T C 4: 84,276,313 H858R possibly damaging Het
Btnl6 T C 17: 34,508,069 S496G probably benign Het
Ccdc88a T C 11: 29,460,860 S449P probably benign Het
Cdh23 A T 10: 60,410,910 D916E probably damaging Het
Cfap43 A T 19: 47,748,017 L1345H possibly damaging Het
Cyld A T 8: 88,729,510 H396L probably benign Het
Cyp20a1 A G 1: 60,379,420 T340A possibly damaging Het
Dera A T 6: 137,830,204 I217F probably damaging Het
Dnah11 A G 12: 118,190,804 L247P probably damaging Het
Eftud2 G A 11: 102,868,621 T152M probably damaging Het
Epb41l2 C T 10: 25,443,776 T169M probably benign Het
Fam186a T C 15: 99,947,142 D407G unknown Het
Fam189a2 T C 19: 23,988,494 K214E probably damaging Het
Gli3 T A 13: 15,715,034 C578S probably damaging Het
Gm6408 A G 5: 146,482,427 N84S probably benign Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,887,919 probably benign Het
Herc2 C A 7: 56,188,613 T3296K probably damaging Het
Hnf4g A T 3: 3,643,073 probably benign Het
Hyal4 C A 6: 24,755,827 Q15K probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcna3 A G 3: 107,036,592 E57G probably damaging Het
Kcnc3 C A 7: 44,591,596 D237E probably benign Het
Map3k8 A G 18: 4,343,137 V130A probably benign Het
Mpp7 A G 18: 7,440,430 probably null Het
Myh13 T A 11: 67,342,485 L610Q probably damaging Het
Olfr1020 T A 2: 85,849,902 M150K probably benign Het
Olfr1339 C A 4: 118,735,038 P170T probably damaging Het
Olfr917 T C 9: 38,665,768 I25M probably benign Het
Pcdhb5 A T 18: 37,321,076 T170S probably benign Het
Polr3b T A 10: 84,680,387 H626Q probably benign Het
Prkg1 A T 19: 31,764,746 L26Q probably damaging Het
Prob1 T C 18: 35,653,986 N405S possibly damaging Het
Proz T G 8: 13,073,630 S300R probably damaging Het
Psg19 A G 7: 18,794,065 I251T probably benign Het
Rcbtb1 T C 14: 59,229,952 I413T possibly damaging Het
Rnf144b T A 13: 47,228,976 Y103N probably damaging Het
Rspry1 G C 8: 94,632,119 G194R probably benign Het
Scn2b A G 9: 45,125,619 I142V probably damaging Het
Spata20 A T 11: 94,481,781 L588H probably damaging Het
Stk32b T A 5: 37,457,159 H335L probably benign Het
Taar4 A C 10: 23,960,903 D137A possibly damaging Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tek A T 4: 94,849,837 H708L probably benign Het
Tmem89 C T 9: 108,915,027 L132F unknown Het
Ugt2b38 T C 5: 87,411,822 I404V probably benign Het
Vmn1r16 C T 6: 57,322,829 M269I probably benign Het
Vmn1r201 A G 13: 22,475,252 K212R probably damaging Het
Vmn2r11 A C 5: 109,053,760 F293V probably damaging Het
Zdhhc17 A T 10: 110,962,379 probably benign Het
Zfp423 C A 8: 87,782,710 M335I probably benign Het
Zfp74 T C 7: 29,934,654 Y543C probably damaging Het
Zfp975 A T 7: 42,662,840 S116R probably benign Het
Other mutations in Gm436
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Gm436 APN 4 144673779 missense probably benign 0.12
IGL01369:Gm436 APN 4 144674645 missense possibly damaging 0.50
IGL01503:Gm436 APN 4 144674567 missense probably damaging 0.99
IGL01505:Gm436 APN 4 144674618 missense probably damaging 1.00
IGL01954:Gm436 APN 4 144670171 missense probably damaging 1.00
IGL02447:Gm436 APN 4 144674699 missense probably benign 0.02
IGL02804:Gm436 APN 4 144670439 missense possibly damaging 0.95
R0373:Gm436 UTSW 4 144686220 missense possibly damaging 0.54
R1124:Gm436 UTSW 4 144670275 missense probably benign 0.00
R1598:Gm436 UTSW 4 144670424 missense possibly damaging 0.60
R1734:Gm436 UTSW 4 144670026 missense probably benign 0.04
R1763:Gm436 UTSW 4 144669959 missense probably benign 0.24
R1968:Gm436 UTSW 4 144670623 missense possibly damaging 0.83
R3055:Gm436 UTSW 4 144674698 missense probably benign 0.16
R3056:Gm436 UTSW 4 144674698 missense probably benign 0.16
R3930:Gm436 UTSW 4 144670128 missense probably damaging 1.00
R5124:Gm436 UTSW 4 144674719 missense probably damaging 1.00
R5407:Gm436 UTSW 4 144670325 missense probably benign 0.01
R6302:Gm436 UTSW 4 144670190 nonsense probably null
R6814:Gm436 UTSW 4 144670646 nonsense probably null
R6872:Gm436 UTSW 4 144670646 nonsense probably null
R6988:Gm436 UTSW 4 144686325 missense probably benign 0.01
R7131:Gm436 UTSW 4 144670067 missense probably damaging 0.98
R7895:Gm436 UTSW 4 144670343 missense possibly damaging 0.95
R8108:Gm436 UTSW 4 144670669 missense probably benign 0.04
R8378:Gm436 UTSW 4 144670599 missense probably benign 0.24
R8817:Gm436 UTSW 4 144673791 missense probably benign 0.00
R9328:Gm436 UTSW 4 144674686 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTCATTACACAAAGACCAGAGTGAC -3'
(R):5'- ACAGAAAATGGCTCAGCTCTG -3'

Sequencing Primer
(F):5'- AGACCAGAGTGACTATCATATGC -3'
(R):5'- AATGGCTCAGCTCTGACAATATTCC -3'
Posted On 2021-03-08