Incidental Mutation 'R8676:Psg19'
ID 661381
Institutional Source Beutler Lab
Gene Symbol Psg19
Ensembl Gene ENSMUSG00000004542
Gene Name pregnancy specific glycoprotein 19
Synonyms CGM7, Cea-4, Cea4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # R8676 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 18789567-18798520 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 18794065 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 251 (I251T)
Ref Sequence ENSEMBL: ENSMUSP00000004657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004657] [ENSMUST00000182853]
AlphaFold Q4KL31
Predicted Effect probably benign
Transcript: ENSMUST00000004657
AA Change: I251T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000004657
Gene: ENSMUSG00000004542
AA Change: I251T

DomainStartEndE-ValueType
IG 40 141 9.2e-3 SMART
IG 160 261 4.5e0 SMART
IG 280 381 4.67e-4 SMART
IGc2 397 461 1.58e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182853
SMART Domains Protein: ENSMUSP00000138621
Gene: ENSMUSG00000004542

DomainStartEndE-ValueType
IG 40 141 9.2e-3 SMART
IG 160 261 4.67e-4 SMART
IGc2 277 341 1.58e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 93% (54/58)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik A G 4: 107,895,599 N152D unknown Het
1700021F05Rik A G 10: 43,532,937 L70S probably benign Het
Acsm3 T A 7: 119,775,169 S281R probably damaging Het
Adipor2 G T 6: 119,363,486 probably benign Het
Alk T C 17: 71,897,941 S1079G probably damaging Het
Ankrd27 T C 7: 35,602,584 probably null Het
Anxa6 C A 11: 55,001,282 E283* probably null Het
Bnc2 T C 4: 84,276,313 H858R possibly damaging Het
Btnl6 T C 17: 34,508,069 S496G probably benign Het
Ccdc88a T C 11: 29,460,860 S449P probably benign Het
Cdh23 A T 10: 60,410,910 D916E probably damaging Het
Cfap43 A T 19: 47,748,017 L1345H possibly damaging Het
Cyld A T 8: 88,729,510 H396L probably benign Het
Cyp20a1 A G 1: 60,379,420 T340A possibly damaging Het
Dera A T 6: 137,830,204 I217F probably damaging Het
Dnah11 A G 12: 118,190,804 L247P probably damaging Het
Eftud2 G A 11: 102,868,621 T152M probably damaging Het
Epb41l2 C T 10: 25,443,776 T169M probably benign Het
Fam186a T C 15: 99,947,142 D407G unknown Het
Fam189a2 T C 19: 23,988,494 K214E probably damaging Het
Gli3 T A 13: 15,715,034 C578S probably damaging Het
Gm436 G A 4: 144,670,113 R350C possibly damaging Het
Gm6408 A G 5: 146,482,427 N84S probably benign Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,887,919 probably benign Het
Herc2 C A 7: 56,188,613 T3296K probably damaging Het
Hnf4g A T 3: 3,643,073 probably benign Het
Hyal4 C A 6: 24,755,827 Q15K probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcna3 A G 3: 107,036,592 E57G probably damaging Het
Kcnc3 C A 7: 44,591,596 D237E probably benign Het
Map3k8 A G 18: 4,343,137 V130A probably benign Het
Mpp7 A G 18: 7,440,430 probably null Het
Myh13 T A 11: 67,342,485 L610Q probably damaging Het
Olfr1020 T A 2: 85,849,902 M150K probably benign Het
Olfr1339 C A 4: 118,735,038 P170T probably damaging Het
Olfr917 T C 9: 38,665,768 I25M probably benign Het
Pcdhb5 A T 18: 37,321,076 T170S probably benign Het
Polr3b T A 10: 84,680,387 H626Q probably benign Het
Prkg1 A T 19: 31,764,746 L26Q probably damaging Het
Prob1 T C 18: 35,653,986 N405S possibly damaging Het
Proz T G 8: 13,073,630 S300R probably damaging Het
Rcbtb1 T C 14: 59,229,952 I413T possibly damaging Het
Rnf144b T A 13: 47,228,976 Y103N probably damaging Het
Rspry1 G C 8: 94,632,119 G194R probably benign Het
Scn2b A G 9: 45,125,619 I142V probably damaging Het
Spata20 A T 11: 94,481,781 L588H probably damaging Het
Stk32b T A 5: 37,457,159 H335L probably benign Het
Taar4 A C 10: 23,960,903 D137A possibly damaging Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tek A T 4: 94,849,837 H708L probably benign Het
Tmem89 C T 9: 108,915,027 L132F unknown Het
Ugt2b38 T C 5: 87,411,822 I404V probably benign Het
Vmn1r16 C T 6: 57,322,829 M269I probably benign Het
Vmn1r201 A G 13: 22,475,252 K212R probably damaging Het
Vmn2r11 A C 5: 109,053,760 F293V probably damaging Het
Zdhhc17 A T 10: 110,962,379 probably benign Het
Zfp423 C A 8: 87,782,710 M335I probably benign Het
Zfp74 T C 7: 29,934,654 Y543C probably damaging Het
Zfp975 A T 7: 42,662,840 S116R probably benign Het
Other mutations in Psg19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Psg19 APN 7 18794046 nonsense probably null
IGL01864:Psg19 APN 7 18794152 missense probably benign 0.03
IGL01996:Psg19 APN 7 18790061 missense possibly damaging 0.45
IGL02603:Psg19 APN 7 18792768 missense probably benign 0.04
PIT4280001:Psg19 UTSW 7 18796906 missense probably damaging 0.98
R0139:Psg19 UTSW 7 18797017 missense possibly damaging 0.65
R0894:Psg19 UTSW 7 18794062 missense probably benign 0.14
R1394:Psg19 UTSW 7 18797058 missense probably damaging 0.99
R1911:Psg19 UTSW 7 18794268 missense probably damaging 0.96
R2116:Psg19 UTSW 7 18794255 missense probably damaging 0.99
R2165:Psg19 UTSW 7 18796986 missense possibly damaging 0.70
R4791:Psg19 UTSW 7 18794146 missense probably damaging 1.00
R5093:Psg19 UTSW 7 18796969 missense probably benign 0.00
R6290:Psg19 UTSW 7 18794089 missense probably benign 0.00
R7255:Psg19 UTSW 7 18794048 missense probably benign 0.17
R7718:Psg19 UTSW 7 18792443 missense probably benign 0.05
R8751:Psg19 UTSW 7 18796963 missense probably benign 0.27
R9022:Psg19 UTSW 7 18796837 missense probably benign 0.01
R9022:Psg19 UTSW 7 18797119 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TTAGGTCCTCCGACATACCAC -3'
(R):5'- AACAAGGTTGAGATTGCCCG -3'

Sequencing Primer
(F):5'- AGAGTCTAACCCATGGGCATTTC -3'
(R):5'- TTGAGATTGCCCGGCACAG -3'
Posted On 2021-03-08