Incidental Mutation 'R8676:Ankrd27'
ID661383
Institutional Source Beutler Lab
Gene Symbol Ankrd27
Ensembl Gene ENSMUSG00000034867
Gene Nameankyrin repeat domain 27 (VPS9 domain)
SynonymsD330003H11Rik, Varp
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8676 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location35586244-35639226 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 35602584 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000041751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040844] [ENSMUST00000186245] [ENSMUST00000188906] [ENSMUST00000190503] [ENSMUST00000206157] [ENSMUST00000206472]
Predicted Effect probably null
Transcript: ENSMUST00000040844
SMART Domains Protein: ENSMUSP00000041751
Gene: ENSMUSG00000034867

DomainStartEndE-ValueType
Blast:ANK 8 37 2e-8 BLAST
VPS9 264 380 1.92e-7 SMART
Blast:ANK 393 418 8e-9 BLAST
low complexity region 419 430 N/A INTRINSIC
ANK 462 491 8.65e-5 SMART
ANK 495 524 1.8e-2 SMART
ANK 528 558 2.45e-4 SMART
ANK 564 593 6.46e-4 SMART
low complexity region 638 658 N/A INTRINSIC
ANK 742 774 8.39e-3 SMART
ANK 775 804 5.93e-3 SMART
ANK 808 837 4.46e-7 SMART
ANK 841 870 2.81e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186245
SMART Domains Protein: ENSMUSP00000140554
Gene: ENSMUSG00000034867

DomainStartEndE-ValueType
Blast:ANK 8 37 1e-8 BLAST
VPS9 264 377 2.19e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188906
SMART Domains Protein: ENSMUSP00000139753
Gene: ENSMUSG00000034867

DomainStartEndE-ValueType
Blast:ANK 8 37 4e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000190503
SMART Domains Protein: ENSMUSP00000140259
Gene: ENSMUSG00000034867

DomainStartEndE-ValueType
Blast:ANK 8 37 2e-8 BLAST
VPS9 264 380 1.92e-7 SMART
Blast:ANK 393 418 7e-9 BLAST
low complexity region 419 430 N/A INTRINSIC
ANK 462 491 8.65e-5 SMART
ANK 495 524 1.8e-2 SMART
ANK 528 558 2.45e-4 SMART
ANK 564 593 6.46e-4 SMART
low complexity region 638 658 N/A INTRINSIC
ANK 687 719 8.39e-3 SMART
ANK 720 749 5.93e-3 SMART
ANK 753 782 4.46e-7 SMART
ANK 786 815 2.81e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206157
Predicted Effect probably benign
Transcript: ENSMUST00000206472
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 93% (54/58)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik A G 4: 107,895,599 N152D unknown Het
1700021F05Rik A G 10: 43,532,937 L70S probably benign Het
Acsm3 T A 7: 119,775,169 S281R probably damaging Het
Adipor2 G T 6: 119,363,486 probably benign Het
Alk T C 17: 71,897,941 S1079G probably damaging Het
Anxa6 C A 11: 55,001,282 E283* probably null Het
Bnc2 T C 4: 84,276,313 H858R possibly damaging Het
Btnl6 T C 17: 34,508,069 S496G probably benign Het
Ccdc88a T C 11: 29,460,860 S449P probably benign Het
Cdh23 A T 10: 60,410,910 D916E probably damaging Het
Cfap43 A T 19: 47,748,017 L1345H possibly damaging Het
Cyld A T 8: 88,729,510 H396L probably benign Het
Cyp20a1 A G 1: 60,379,420 T340A possibly damaging Het
Dera A T 6: 137,830,204 I217F probably damaging Het
Dnah11 A G 12: 118,190,804 L247P probably damaging Het
Eftud2 G A 11: 102,868,621 T152M probably damaging Het
Epb41l2 C T 10: 25,443,776 T169M probably benign Het
Fam186a T C 15: 99,947,142 D407G unknown Het
Fam189a2 T C 19: 23,988,494 K214E probably damaging Het
Gli3 T A 13: 15,715,034 C578S probably damaging Het
Gm436 G A 4: 144,670,113 R350C possibly damaging Het
Gm6408 A G 5: 146,482,427 N84S probably benign Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,887,919 probably benign Het
Herc2 C A 7: 56,188,613 T3296K probably damaging Het
Hnf4g A T 3: 3,643,073 probably benign Het
Hyal4 C A 6: 24,755,827 Q15K probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcna3 A G 3: 107,036,592 E57G probably damaging Het
Kcnc3 C A 7: 44,591,596 D237E probably benign Het
Map3k8 A G 18: 4,343,137 V130A probably benign Het
Mpp7 A G 18: 7,440,430 probably null Het
Myh13 T A 11: 67,342,485 L610Q probably damaging Het
Olfr1020 T A 2: 85,849,902 M150K probably benign Het
Olfr1339 C A 4: 118,735,038 P170T probably damaging Het
Olfr917 T C 9: 38,665,768 I25M probably benign Het
Pcdhb5 A T 18: 37,321,076 T170S probably benign Het
Polr3b T A 10: 84,680,387 H626Q probably benign Het
Prkg1 A T 19: 31,764,746 L26Q probably damaging Het
Prob1 T C 18: 35,653,986 N405S possibly damaging Het
Proz T G 8: 13,073,630 S300R probably damaging Het
Psg19 A G 7: 18,794,065 I251T probably benign Het
Rcbtb1 T C 14: 59,229,952 I413T possibly damaging Het
Rnf144b T A 13: 47,228,976 Y103N probably damaging Het
Rspry1 G C 8: 94,632,119 G194R probably benign Het
Scn2b A G 9: 45,125,619 I142V probably damaging Het
Spata20 A T 11: 94,481,781 L588H probably damaging Het
Stk32b T A 5: 37,457,159 H335L probably benign Het
Taar4 A C 10: 23,960,903 D137A possibly damaging Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tek A T 4: 94,849,837 H708L probably benign Het
Tmem89 C T 9: 108,915,027 L132F unknown Het
Ugt2b38 T C 5: 87,411,822 I404V probably benign Het
Vmn1r16 C T 6: 57,322,829 M269I probably benign Het
Vmn1r201 A G 13: 22,475,252 K212R probably damaging Het
Vmn2r11 A C 5: 109,053,760 F293V probably damaging Het
Zdhhc17 A T 10: 110,962,379 probably benign Het
Zfp423 C A 8: 87,782,710 M335I probably benign Het
Zfp74 T C 7: 29,934,654 Y543C probably damaging Het
Zfp975 A T 7: 42,662,840 S116R probably benign Het
Other mutations in Ankrd27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02021:Ankrd27 APN 7 35614456 missense probably damaging 0.99
IGL02205:Ankrd27 APN 7 35616939 missense probably damaging 1.00
IGL02372:Ankrd27 APN 7 35633036 splice site probably null
IGL02629:Ankrd27 APN 7 35625696 missense probably benign 0.00
IGL03394:Ankrd27 APN 7 35607098 splice site probably null
R0008:Ankrd27 UTSW 7 35603700 missense probably benign 0.11
R0008:Ankrd27 UTSW 7 35603700 missense probably benign 0.11
R0233:Ankrd27 UTSW 7 35601560 missense probably damaging 1.00
R0233:Ankrd27 UTSW 7 35601560 missense probably damaging 1.00
R0240:Ankrd27 UTSW 7 35619439 missense probably damaging 1.00
R0240:Ankrd27 UTSW 7 35619439 missense probably damaging 1.00
R0281:Ankrd27 UTSW 7 35619371 missense probably damaging 0.98
R0373:Ankrd27 UTSW 7 35638053 missense probably benign 0.00
R0833:Ankrd27 UTSW 7 35608347 missense probably damaging 1.00
R0836:Ankrd27 UTSW 7 35608347 missense probably damaging 1.00
R1191:Ankrd27 UTSW 7 35602487 missense probably damaging 0.96
R1394:Ankrd27 UTSW 7 35615869 missense possibly damaging 0.80
R1395:Ankrd27 UTSW 7 35615869 missense possibly damaging 0.80
R1493:Ankrd27 UTSW 7 35608365 missense probably benign 0.11
R1648:Ankrd27 UTSW 7 35603853 missense probably benign 0.00
R1664:Ankrd27 UTSW 7 35607126 missense probably damaging 1.00
R1698:Ankrd27 UTSW 7 35614521 missense probably benign 0.01
R1717:Ankrd27 UTSW 7 35628446 missense possibly damaging 0.87
R1919:Ankrd27 UTSW 7 35632985 missense probably benign
R1956:Ankrd27 UTSW 7 35603839 missense probably damaging 1.00
R2276:Ankrd27 UTSW 7 35615840 unclassified probably benign
R3000:Ankrd27 UTSW 7 35608330 missense probably damaging 1.00
R4604:Ankrd27 UTSW 7 35628490 missense probably damaging 1.00
R4647:Ankrd27 UTSW 7 35638234 missense probably benign
R4838:Ankrd27 UTSW 7 35591806 missense possibly damaging 0.87
R4896:Ankrd27 UTSW 7 35608375 missense probably damaging 1.00
R4973:Ankrd27 UTSW 7 35632992 missense probably benign
R5004:Ankrd27 UTSW 7 35608375 missense probably damaging 1.00
R5069:Ankrd27 UTSW 7 35628435 missense probably damaging 0.98
R5182:Ankrd27 UTSW 7 35628487 missense probably damaging 1.00
R5330:Ankrd27 UTSW 7 35615926 nonsense probably null
R5458:Ankrd27 UTSW 7 35591811 missense probably damaging 1.00
R6293:Ankrd27 UTSW 7 35608460 missense possibly damaging 0.65
R6341:Ankrd27 UTSW 7 35627403 critical splice acceptor site probably null
R6721:Ankrd27 UTSW 7 35612551 missense probably damaging 1.00
R6860:Ankrd27 UTSW 7 35628527 missense possibly damaging 0.62
R7027:Ankrd27 UTSW 7 35612526 missense probably benign 0.00
R7177:Ankrd27 UTSW 7 35619397 missense probably damaging 1.00
R7231:Ankrd27 UTSW 7 35628446 missense possibly damaging 0.87
R7289:Ankrd27 UTSW 7 35631249 missense probably damaging 1.00
R7933:Ankrd27 UTSW 7 35601649 splice site probably benign
R8011:Ankrd27 UTSW 7 35616881 missense probably benign 0.01
R8198:Ankrd27 UTSW 7 35608455 missense probably benign 0.01
R8214:Ankrd27 UTSW 7 35614519 missense probably damaging 1.00
R8327:Ankrd27 UTSW 7 35601560 missense probably damaging 1.00
R8461:Ankrd27 UTSW 7 35627486 missense probably damaging 1.00
R8508:Ankrd27 UTSW 7 35601626 nonsense probably null
Z1177:Ankrd27 UTSW 7 35603878 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- CCCCATTGTTCAGAAAACGG -3'
(R):5'- TTCCTGAAGGGTCTTATGCTAC -3'

Sequencing Primer
(F):5'- TGTTCAGAAAACGGAAAACTCTAGC -3'
(R):5'- ACTTTATATGCCCCAGTACAGG -3'
Posted On2021-03-08