Incidental Mutation 'R8676:Ankrd27'
ID 661383
Institutional Source Beutler Lab
Gene Symbol Ankrd27
Ensembl Gene ENSMUSG00000034867
Gene Name ankyrin repeat domain 27 (VPS9 domain)
Synonyms D330003H11Rik, Varp
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8676 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 35586244-35639226 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 35602584 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000041751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040844] [ENSMUST00000186245] [ENSMUST00000188906] [ENSMUST00000190503] [ENSMUST00000206157] [ENSMUST00000206472]
AlphaFold Q3UMR0
Predicted Effect probably null
Transcript: ENSMUST00000040844
SMART Domains Protein: ENSMUSP00000041751
Gene: ENSMUSG00000034867

DomainStartEndE-ValueType
Blast:ANK 8 37 2e-8 BLAST
VPS9 264 380 1.92e-7 SMART
Blast:ANK 393 418 8e-9 BLAST
low complexity region 419 430 N/A INTRINSIC
ANK 462 491 8.65e-5 SMART
ANK 495 524 1.8e-2 SMART
ANK 528 558 2.45e-4 SMART
ANK 564 593 6.46e-4 SMART
low complexity region 638 658 N/A INTRINSIC
ANK 742 774 8.39e-3 SMART
ANK 775 804 5.93e-3 SMART
ANK 808 837 4.46e-7 SMART
ANK 841 870 2.81e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186245
SMART Domains Protein: ENSMUSP00000140554
Gene: ENSMUSG00000034867

DomainStartEndE-ValueType
Blast:ANK 8 37 1e-8 BLAST
VPS9 264 377 2.19e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188906
SMART Domains Protein: ENSMUSP00000139753
Gene: ENSMUSG00000034867

DomainStartEndE-ValueType
Blast:ANK 8 37 4e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000190503
SMART Domains Protein: ENSMUSP00000140259
Gene: ENSMUSG00000034867

DomainStartEndE-ValueType
Blast:ANK 8 37 2e-8 BLAST
VPS9 264 380 1.92e-7 SMART
Blast:ANK 393 418 7e-9 BLAST
low complexity region 419 430 N/A INTRINSIC
ANK 462 491 8.65e-5 SMART
ANK 495 524 1.8e-2 SMART
ANK 528 558 2.45e-4 SMART
ANK 564 593 6.46e-4 SMART
low complexity region 638 658 N/A INTRINSIC
ANK 687 719 8.39e-3 SMART
ANK 720 749 5.93e-3 SMART
ANK 753 782 4.46e-7 SMART
ANK 786 815 2.81e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206157
Predicted Effect probably benign
Transcript: ENSMUST00000206472
Meta Mutation Damage Score 0.9504 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 93% (54/58)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik A G 4: 107,895,599 N152D unknown Het
1700021F05Rik A G 10: 43,532,937 L70S probably benign Het
Acsm3 T A 7: 119,775,169 S281R probably damaging Het
Adipor2 G T 6: 119,363,486 probably benign Het
Alk T C 17: 71,897,941 S1079G probably damaging Het
Anxa6 C A 11: 55,001,282 E283* probably null Het
Bnc2 T C 4: 84,276,313 H858R possibly damaging Het
Btnl6 T C 17: 34,508,069 S496G probably benign Het
Ccdc88a T C 11: 29,460,860 S449P probably benign Het
Cdh23 A T 10: 60,410,910 D916E probably damaging Het
Cfap43 A T 19: 47,748,017 L1345H possibly damaging Het
Cyld A T 8: 88,729,510 H396L probably benign Het
Cyp20a1 A G 1: 60,379,420 T340A possibly damaging Het
Dera A T 6: 137,830,204 I217F probably damaging Het
Dnah11 A G 12: 118,190,804 L247P probably damaging Het
Eftud2 G A 11: 102,868,621 T152M probably damaging Het
Epb41l2 C T 10: 25,443,776 T169M probably benign Het
Fam186a T C 15: 99,947,142 D407G unknown Het
Fam189a2 T C 19: 23,988,494 K214E probably damaging Het
Gli3 T A 13: 15,715,034 C578S probably damaging Het
Gm436 G A 4: 144,670,113 R350C possibly damaging Het
Gm6408 A G 5: 146,482,427 N84S probably benign Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,887,919 probably benign Het
Herc2 C A 7: 56,188,613 T3296K probably damaging Het
Hnf4g A T 3: 3,643,073 probably benign Het
Hyal4 C A 6: 24,755,827 Q15K probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcna3 A G 3: 107,036,592 E57G probably damaging Het
Kcnc3 C A 7: 44,591,596 D237E probably benign Het
Map3k8 A G 18: 4,343,137 V130A probably benign Het
Mpp7 A G 18: 7,440,430 probably null Het
Myh13 T A 11: 67,342,485 L610Q probably damaging Het
Olfr1020 T A 2: 85,849,902 M150K probably benign Het
Olfr1339 C A 4: 118,735,038 P170T probably damaging Het
Olfr917 T C 9: 38,665,768 I25M probably benign Het
Pcdhb5 A T 18: 37,321,076 T170S probably benign Het
Polr3b T A 10: 84,680,387 H626Q probably benign Het
Prkg1 A T 19: 31,764,746 L26Q probably damaging Het
Prob1 T C 18: 35,653,986 N405S possibly damaging Het
Proz T G 8: 13,073,630 S300R probably damaging Het
Psg19 A G 7: 18,794,065 I251T probably benign Het
Rcbtb1 T C 14: 59,229,952 I413T possibly damaging Het
Rnf144b T A 13: 47,228,976 Y103N probably damaging Het
Rspry1 G C 8: 94,632,119 G194R probably benign Het
Scn2b A G 9: 45,125,619 I142V probably damaging Het
Spata20 A T 11: 94,481,781 L588H probably damaging Het
Stk32b T A 5: 37,457,159 H335L probably benign Het
Taar4 A C 10: 23,960,903 D137A possibly damaging Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tek A T 4: 94,849,837 H708L probably benign Het
Tmem89 C T 9: 108,915,027 L132F unknown Het
Ugt2b38 T C 5: 87,411,822 I404V probably benign Het
Vmn1r16 C T 6: 57,322,829 M269I probably benign Het
Vmn1r201 A G 13: 22,475,252 K212R probably damaging Het
Vmn2r11 A C 5: 109,053,760 F293V probably damaging Het
Zdhhc17 A T 10: 110,962,379 probably benign Het
Zfp423 C A 8: 87,782,710 M335I probably benign Het
Zfp74 T C 7: 29,934,654 Y543C probably damaging Het
Zfp975 A T 7: 42,662,840 S116R probably benign Het
Other mutations in Ankrd27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02021:Ankrd27 APN 7 35614456 missense probably damaging 0.99
IGL02205:Ankrd27 APN 7 35616939 missense probably damaging 1.00
IGL02372:Ankrd27 APN 7 35633036 splice site probably null
IGL02629:Ankrd27 APN 7 35625696 missense probably benign 0.00
IGL03394:Ankrd27 APN 7 35607098 splice site probably null
deep_blue UTSW 7 35608455 missense probably benign 0.01
Rapture UTSW 7 35602584 critical splice donor site probably null
R0008:Ankrd27 UTSW 7 35603700 missense probably benign 0.11
R0008:Ankrd27 UTSW 7 35603700 missense probably benign 0.11
R0233:Ankrd27 UTSW 7 35601560 missense probably damaging 1.00
R0233:Ankrd27 UTSW 7 35601560 missense probably damaging 1.00
R0240:Ankrd27 UTSW 7 35619439 missense probably damaging 1.00
R0240:Ankrd27 UTSW 7 35619439 missense probably damaging 1.00
R0281:Ankrd27 UTSW 7 35619371 missense probably damaging 0.98
R0373:Ankrd27 UTSW 7 35638053 missense probably benign 0.00
R0833:Ankrd27 UTSW 7 35608347 missense probably damaging 1.00
R0836:Ankrd27 UTSW 7 35608347 missense probably damaging 1.00
R1191:Ankrd27 UTSW 7 35602487 missense probably damaging 0.96
R1394:Ankrd27 UTSW 7 35615869 missense possibly damaging 0.80
R1395:Ankrd27 UTSW 7 35615869 missense possibly damaging 0.80
R1493:Ankrd27 UTSW 7 35608365 missense probably benign 0.11
R1648:Ankrd27 UTSW 7 35603853 missense probably benign 0.00
R1664:Ankrd27 UTSW 7 35607126 missense probably damaging 1.00
R1698:Ankrd27 UTSW 7 35614521 missense probably benign 0.01
R1717:Ankrd27 UTSW 7 35628446 missense possibly damaging 0.87
R1919:Ankrd27 UTSW 7 35632985 missense probably benign
R1956:Ankrd27 UTSW 7 35603839 missense probably damaging 1.00
R2276:Ankrd27 UTSW 7 35615840 unclassified probably benign
R3000:Ankrd27 UTSW 7 35608330 missense probably damaging 1.00
R4604:Ankrd27 UTSW 7 35628490 missense probably damaging 1.00
R4647:Ankrd27 UTSW 7 35638234 missense probably benign
R4838:Ankrd27 UTSW 7 35591806 missense possibly damaging 0.87
R4896:Ankrd27 UTSW 7 35608375 missense probably damaging 1.00
R4973:Ankrd27 UTSW 7 35632992 missense probably benign
R5004:Ankrd27 UTSW 7 35608375 missense probably damaging 1.00
R5069:Ankrd27 UTSW 7 35628435 missense probably damaging 0.98
R5182:Ankrd27 UTSW 7 35628487 missense probably damaging 1.00
R5330:Ankrd27 UTSW 7 35615926 nonsense probably null
R5458:Ankrd27 UTSW 7 35591811 missense probably damaging 1.00
R6293:Ankrd27 UTSW 7 35608460 missense possibly damaging 0.65
R6341:Ankrd27 UTSW 7 35627403 critical splice acceptor site probably null
R6721:Ankrd27 UTSW 7 35612551 missense probably damaging 1.00
R6860:Ankrd27 UTSW 7 35628527 missense possibly damaging 0.62
R7027:Ankrd27 UTSW 7 35612526 missense probably benign 0.00
R7177:Ankrd27 UTSW 7 35619397 missense probably damaging 1.00
R7231:Ankrd27 UTSW 7 35628446 missense possibly damaging 0.87
R7289:Ankrd27 UTSW 7 35631249 missense probably damaging 1.00
R7933:Ankrd27 UTSW 7 35601649 splice site probably benign
R8011:Ankrd27 UTSW 7 35616881 missense probably benign 0.01
R8198:Ankrd27 UTSW 7 35608455 missense probably benign 0.01
R8214:Ankrd27 UTSW 7 35614519 missense probably damaging 1.00
R8327:Ankrd27 UTSW 7 35601560 missense probably damaging 1.00
R8461:Ankrd27 UTSW 7 35627486 missense probably damaging 1.00
R8508:Ankrd27 UTSW 7 35601626 nonsense probably null
R8901:Ankrd27 UTSW 7 35632818 intron probably benign
R9276:Ankrd27 UTSW 7 35620570 missense probably benign 0.01
R9286:Ankrd27 UTSW 7 35627444 missense probably benign 0.05
R9400:Ankrd27 UTSW 7 35616857 missense probably damaging 1.00
Z1177:Ankrd27 UTSW 7 35603878 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- CCCCATTGTTCAGAAAACGG -3'
(R):5'- TTCCTGAAGGGTCTTATGCTAC -3'

Sequencing Primer
(F):5'- TGTTCAGAAAACGGAAAACTCTAGC -3'
(R):5'- ACTTTATATGCCCCAGTACAGG -3'
Posted On 2021-03-08