Incidental Mutation 'R8676:Kcnc3'
ID 661385
Institutional Source Beutler Lab
Gene Symbol Kcnc3
Ensembl Gene ENSMUSG00000062785
Gene Name potassium voltage gated channel, Shaw-related subfamily, member 3
Synonyms Kcr2-3, KShIIID, Kv3.3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8676 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 44590664-44604754 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 44591596 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 237 (D237E)
Ref Sequence ENSEMBL: ENSMUSP00000103539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002274] [ENSMUST00000107906] [ENSMUST00000107907] [ENSMUST00000207493] [ENSMUST00000208651] [ENSMUST00000209177]
AlphaFold Q63959
Predicted Effect probably benign
Transcript: ENSMUST00000002274
SMART Domains Protein: ENSMUSP00000002274
Gene: ENSMUSG00000002204

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Asp 72 396 6.6e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107906
AA Change: D237E

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000103539
Gene: ENSMUSG00000062785
AA Change: D237E

DomainStartEndE-ValueType
Pfam:Potassium_chann 1 21 8e-9 PFAM
BTB 90 194 4.38e-12 SMART
low complexity region 211 243 N/A INTRINSIC
low complexity region 251 267 N/A INTRINSIC
Pfam:Ion_trans 290 551 4.1e-45 PFAM
Pfam:Ion_trans_2 451 544 8.2e-12 PFAM
low complexity region 578 605 N/A INTRINSIC
low complexity region 622 650 N/A INTRINSIC
low complexity region 730 746 N/A INTRINSIC
low complexity region 750 767 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107907
AA Change: D237E

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000103540
Gene: ENSMUSG00000062785
AA Change: D237E

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
BTB 90 194 4.38e-12 SMART
low complexity region 211 243 N/A INTRINSIC
low complexity region 251 267 N/A INTRINSIC
Pfam:Ion_trans 351 539 1.5e-31 PFAM
Pfam:Ion_trans_2 450 544 2.4e-11 PFAM
low complexity region 578 605 N/A INTRINSIC
low complexity region 622 650 N/A INTRINSIC
low complexity region 729 745 N/A INTRINSIC
low complexity region 749 766 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000207493
AA Change: D237E
Predicted Effect probably benign
Transcript: ENSMUST00000207497
Predicted Effect probably benign
Transcript: ENSMUST00000208651
AA Change: D237E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000209177
AA Change: D237E

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.0762 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 93% (54/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Shaker gene family of Drosophila encodes components of voltage-gated potassium channels and is comprised of four subfamilies. Based on sequence similarity, this gene is similar to one of these subfamilies, namely the Shaw subfamily. The protein encoded by this gene belongs to the delayed rectifier class of channel proteins and is an integral membrane protein that mediates the voltage-dependent potassium ion permeability of excitable membranes. Alternate splicing results in several transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozgous null mice show no overt phenotype, though mutation of this locus in conjunction with mutations in another potassium channel results in alcohol hypersensitivty, increased locomotion, and spontaneous myoclonus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik A G 4: 107,895,599 N152D unknown Het
1700021F05Rik A G 10: 43,532,937 L70S probably benign Het
Acsm3 T A 7: 119,775,169 S281R probably damaging Het
Adipor2 G T 6: 119,363,486 probably benign Het
Alk T C 17: 71,897,941 S1079G probably damaging Het
Ankrd27 T C 7: 35,602,584 probably null Het
Anxa6 C A 11: 55,001,282 E283* probably null Het
Bnc2 T C 4: 84,276,313 H858R possibly damaging Het
Btnl6 T C 17: 34,508,069 S496G probably benign Het
Ccdc88a T C 11: 29,460,860 S449P probably benign Het
Cdh23 A T 10: 60,410,910 D916E probably damaging Het
Cfap43 A T 19: 47,748,017 L1345H possibly damaging Het
Cyld A T 8: 88,729,510 H396L probably benign Het
Cyp20a1 A G 1: 60,379,420 T340A possibly damaging Het
Dera A T 6: 137,830,204 I217F probably damaging Het
Dnah11 A G 12: 118,190,804 L247P probably damaging Het
Eftud2 G A 11: 102,868,621 T152M probably damaging Het
Epb41l2 C T 10: 25,443,776 T169M probably benign Het
Fam186a T C 15: 99,947,142 D407G unknown Het
Fam189a2 T C 19: 23,988,494 K214E probably damaging Het
Gli3 T A 13: 15,715,034 C578S probably damaging Het
Gm436 G A 4: 144,670,113 R350C possibly damaging Het
Gm6408 A G 5: 146,482,427 N84S probably benign Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,887,919 probably benign Het
Herc2 C A 7: 56,188,613 T3296K probably damaging Het
Hnf4g A T 3: 3,643,073 probably benign Het
Hyal4 C A 6: 24,755,827 Q15K probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcna3 A G 3: 107,036,592 E57G probably damaging Het
Map3k8 A G 18: 4,343,137 V130A probably benign Het
Mpp7 A G 18: 7,440,430 probably null Het
Myh13 T A 11: 67,342,485 L610Q probably damaging Het
Olfr1020 T A 2: 85,849,902 M150K probably benign Het
Olfr1339 C A 4: 118,735,038 P170T probably damaging Het
Olfr917 T C 9: 38,665,768 I25M probably benign Het
Pcdhb5 A T 18: 37,321,076 T170S probably benign Het
Polr3b T A 10: 84,680,387 H626Q probably benign Het
Prkg1 A T 19: 31,764,746 L26Q probably damaging Het
Prob1 T C 18: 35,653,986 N405S possibly damaging Het
Proz T G 8: 13,073,630 S300R probably damaging Het
Psg19 A G 7: 18,794,065 I251T probably benign Het
Rcbtb1 T C 14: 59,229,952 I413T possibly damaging Het
Rnf144b T A 13: 47,228,976 Y103N probably damaging Het
Rspry1 G C 8: 94,632,119 G194R probably benign Het
Scn2b A G 9: 45,125,619 I142V probably damaging Het
Spata20 A T 11: 94,481,781 L588H probably damaging Het
Stk32b T A 5: 37,457,159 H335L probably benign Het
Taar4 A C 10: 23,960,903 D137A possibly damaging Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tek A T 4: 94,849,837 H708L probably benign Het
Tmem89 C T 9: 108,915,027 L132F unknown Het
Ugt2b38 T C 5: 87,411,822 I404V probably benign Het
Vmn1r16 C T 6: 57,322,829 M269I probably benign Het
Vmn1r201 A G 13: 22,475,252 K212R probably damaging Het
Vmn2r11 A C 5: 109,053,760 F293V probably damaging Het
Zdhhc17 A T 10: 110,962,379 probably benign Het
Zfp423 C A 8: 87,782,710 M335I probably benign Het
Zfp74 T C 7: 29,934,654 Y543C probably damaging Het
Zfp975 A T 7: 42,662,840 S116R probably benign Het
Other mutations in Kcnc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Kcnc3 APN 7 44595386 missense probably damaging 1.00
IGL01607:Kcnc3 APN 7 44591304 missense probably damaging 1.00
IGL02397:Kcnc3 APN 7 44595794 missense probably damaging 1.00
IGL02807:Kcnc3 APN 7 44595957 missense probably damaging 1.00
IGL02961:Kcnc3 APN 7 44591492 missense probably damaging 0.99
elfen UTSW 7 44591296 frame shift probably null
Le_fitness UTSW 7 44595182 missense possibly damaging 0.92
Svelte UTSW 7 44595816 missense probably damaging 1.00
Trim UTSW 7 44595603 missense probably damaging 1.00
R0514:Kcnc3 UTSW 7 44595928 nonsense probably null
R0827:Kcnc3 UTSW 7 44595206 missense probably damaging 0.99
R1514:Kcnc3 UTSW 7 44595603 missense probably damaging 1.00
R2875:Kcnc3 UTSW 7 44591537 nonsense probably null
R4597:Kcnc3 UTSW 7 44595816 missense probably damaging 1.00
R4954:Kcnc3 UTSW 7 44591296 frame shift probably null
R4955:Kcnc3 UTSW 7 44591296 frame shift probably null
R6012:Kcnc3 UTSW 7 44598872 missense probably benign 0.26
R6093:Kcnc3 UTSW 7 44591508 missense probably benign 0.44
R6488:Kcnc3 UTSW 7 44595182 missense possibly damaging 0.92
R7542:Kcnc3 UTSW 7 44595714 missense possibly damaging 0.84
R7595:Kcnc3 UTSW 7 44591469 missense probably damaging 1.00
R7909:Kcnc3 UTSW 7 44595687 missense probably damaging 1.00
R7946:Kcnc3 UTSW 7 44596145 missense probably benign 0.13
R9156:Kcnc3 UTSW 7 44591168 missense probably damaging 0.99
R9396:Kcnc3 UTSW 7 44591513 missense possibly damaging 0.57
Z1177:Kcnc3 UTSW 7 44596106 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGGGGCATAGACGAGAC -3'
(R):5'- GAAGGGCTTCCAGAGAACTG -3'

Sequencing Primer
(F):5'- CATAGACGAGACGGACGTG -3'
(R):5'- ACACTGGGATGGAGTGCTC -3'
Posted On 2021-03-08