Incidental Mutation 'R8676:Proz'
ID 661388
Institutional Source Beutler Lab
Gene Symbol Proz
Ensembl Gene ENSMUSG00000031445
Gene Name protein Z, vitamin K-dependent plasma glycoprotein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R8676 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 13060914-13076026 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 13073630 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 300 (S300R)
Ref Sequence ENSEMBL: ENSMUSP00000033822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033822] [ENSMUST00000164416] [ENSMUST00000168164] [ENSMUST00000211363] [ENSMUST00000211453]
AlphaFold Q9CQW3
Predicted Effect probably damaging
Transcript: ENSMUST00000033822
AA Change: S300R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033822
Gene: ENSMUSG00000031445
AA Change: S300R

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
GLA 22 86 7.03e-29 SMART
EGF 90 123 1.65e-6 SMART
EGF 128 166 1.19e-3 SMART
Tryp_SPc 182 394 6.49e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164416
SMART Domains Protein: ENSMUSP00000133204
Gene: ENSMUSG00000038542

DomainStartEndE-ValueType
PAM 144 312 4.29e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168164
Predicted Effect probably benign
Transcript: ENSMUST00000211363
Predicted Effect probably benign
Transcript: ENSMUST00000211453
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 93% (54/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a liver vitamin K-dependent glycoprotein that is synthesized in the liver and secreted into the plasma. The encoded protein plays a role in regulating blood coagulation by complexing with protein Z-dependent protease inhibitor to directly inhibit activated factor X at the phospholipid surface. Deficiencies in this protein are associated with an increased risk of ischemic arterial diseases and fetal loss. Mutations in this gene are the cause of protein Z deficiency. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: When unchallenged, mice homozygous for a knock-out allele do not express an obvious phenotype; however, homozygotes exhibit significantly reduced survival following collagen/epinephrine-induced thromboembolism and develop enhanced thrombosis in the ferric chloride-induced arterial injury model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik A G 4: 107,895,599 N152D unknown Het
1700021F05Rik A G 10: 43,532,937 L70S probably benign Het
Acsm3 T A 7: 119,775,169 S281R probably damaging Het
Adipor2 G T 6: 119,363,486 probably benign Het
Alk T C 17: 71,897,941 S1079G probably damaging Het
Ankrd27 T C 7: 35,602,584 probably null Het
Anxa6 C A 11: 55,001,282 E283* probably null Het
Bnc2 T C 4: 84,276,313 H858R possibly damaging Het
Btnl6 T C 17: 34,508,069 S496G probably benign Het
Ccdc88a T C 11: 29,460,860 S449P probably benign Het
Cdh23 A T 10: 60,410,910 D916E probably damaging Het
Cfap43 A T 19: 47,748,017 L1345H possibly damaging Het
Cyld A T 8: 88,729,510 H396L probably benign Het
Cyp20a1 A G 1: 60,379,420 T340A possibly damaging Het
Dera A T 6: 137,830,204 I217F probably damaging Het
Dnah11 A G 12: 118,190,804 L247P probably damaging Het
Eftud2 G A 11: 102,868,621 T152M probably damaging Het
Epb41l2 C T 10: 25,443,776 T169M probably benign Het
Fam186a T C 15: 99,947,142 D407G unknown Het
Fam189a2 T C 19: 23,988,494 K214E probably damaging Het
Gli3 T A 13: 15,715,034 C578S probably damaging Het
Gm436 G A 4: 144,670,113 R350C possibly damaging Het
Gm6408 A G 5: 146,482,427 N84S probably benign Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,887,919 probably benign Het
Herc2 C A 7: 56,188,613 T3296K probably damaging Het
Hnf4g A T 3: 3,643,073 probably benign Het
Hyal4 C A 6: 24,755,827 Q15K probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcna3 A G 3: 107,036,592 E57G probably damaging Het
Kcnc3 C A 7: 44,591,596 D237E probably benign Het
Map3k8 A G 18: 4,343,137 V130A probably benign Het
Mpp7 A G 18: 7,440,430 probably null Het
Myh13 T A 11: 67,342,485 L610Q probably damaging Het
Olfr1020 T A 2: 85,849,902 M150K probably benign Het
Olfr1339 C A 4: 118,735,038 P170T probably damaging Het
Olfr917 T C 9: 38,665,768 I25M probably benign Het
Pcdhb5 A T 18: 37,321,076 T170S probably benign Het
Polr3b T A 10: 84,680,387 H626Q probably benign Het
Prkg1 A T 19: 31,764,746 L26Q probably damaging Het
Prob1 T C 18: 35,653,986 N405S possibly damaging Het
Psg19 A G 7: 18,794,065 I251T probably benign Het
Rcbtb1 T C 14: 59,229,952 I413T possibly damaging Het
Rnf144b T A 13: 47,228,976 Y103N probably damaging Het
Rspry1 G C 8: 94,632,119 G194R probably benign Het
Scn2b A G 9: 45,125,619 I142V probably damaging Het
Spata20 A T 11: 94,481,781 L588H probably damaging Het
Stk32b T A 5: 37,457,159 H335L probably benign Het
Taar4 A C 10: 23,960,903 D137A possibly damaging Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tek A T 4: 94,849,837 H708L probably benign Het
Tmem89 C T 9: 108,915,027 L132F unknown Het
Ugt2b38 T C 5: 87,411,822 I404V probably benign Het
Vmn1r16 C T 6: 57,322,829 M269I probably benign Het
Vmn1r201 A G 13: 22,475,252 K212R probably damaging Het
Vmn2r11 A C 5: 109,053,760 F293V probably damaging Het
Zdhhc17 A T 10: 110,962,379 probably benign Het
Zfp423 C A 8: 87,782,710 M335I probably benign Het
Zfp74 T C 7: 29,934,654 Y543C probably damaging Het
Zfp975 A T 7: 42,662,840 S116R probably benign Het
Other mutations in Proz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01677:Proz APN 8 13065238 splice site probably benign
IGL01977:Proz APN 8 13066913 missense probably damaging 1.00
IGL02553:Proz APN 8 13065260 missense probably benign 0.00
IGL02991:Proz UTSW 8 13073490 missense probably benign 0.00
R0241:Proz UTSW 8 13065356 missense probably benign 0.02
R0241:Proz UTSW 8 13065356 missense probably benign 0.02
R0482:Proz UTSW 8 13073460 nonsense probably null
R1614:Proz UTSW 8 13066904 missense probably damaging 1.00
R1906:Proz UTSW 8 13073686 splice site probably null
R2230:Proz UTSW 8 13063356 missense probably damaging 0.99
R2232:Proz UTSW 8 13063356 missense probably damaging 0.99
R2444:Proz UTSW 8 13061027 start gained probably benign
R3029:Proz UTSW 8 13061042 missense probably benign
R3847:Proz UTSW 8 13073533 missense probably benign 0.00
R3850:Proz UTSW 8 13073533 missense probably benign 0.00
R4063:Proz UTSW 8 13064621 missense probably damaging 1.00
R5104:Proz UTSW 8 13066931 missense probably damaging 1.00
R5309:Proz UTSW 8 13061049 missense probably damaging 1.00
R5337:Proz UTSW 8 13066854 missense probably benign 0.01
R5447:Proz UTSW 8 13072578 missense probably benign 0.31
R5876:Proz UTSW 8 13073448 missense probably benign 0.05
R6739:Proz UTSW 8 13073451 missense possibly damaging 0.86
R7559:Proz UTSW 8 13063455 missense probably benign 0.01
R7842:Proz UTSW 8 13063406 missense probably benign 0.19
R7867:Proz UTSW 8 13061027 start gained probably benign
R8820:Proz UTSW 8 13063253 missense probably damaging 1.00
R8936:Proz UTSW 8 13065319 missense probably benign 0.01
R9255:Proz UTSW 8 13073472 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TCATGATTTCAGATGTTGACCAGAGG -3'
(R):5'- AACCAGGTGCCCTTGTGTTC -3'

Sequencing Primer
(F):5'- TTTCAGATGTTGACCAGAGGATCAG -3'
(R):5'- GTGTTCTCGGGTCACCACAC -3'
Posted On 2021-03-08