Incidental Mutation 'R8676:Zfp423'
ID 661389
Institutional Source Beutler Lab
Gene Symbol Zfp423
Ensembl Gene ENSMUSG00000045333
Gene Name zinc finger protein 423
Synonyms Zfp104, ataxia1, Ebfaz, Roaz
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.805) question?
Stock # R8676 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 87661810-87959595 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 87782710 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 335 (M335I)
Ref Sequence ENSEMBL: ENSMUSP00000105282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052250] [ENSMUST00000109655] [ENSMUST00000165770] [ENSMUST00000174249] [ENSMUST00000174764]
AlphaFold Q80TS5
Predicted Effect probably benign
Transcript: ENSMUST00000052250
AA Change: M314I

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000052379
Gene: ENSMUSG00000045333
AA Change: M314I

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
ZnF_C2H2 54 75 5.07e0 SMART
low complexity region 107 123 N/A INTRINSIC
ZnF_C2H2 125 147 1.28e-3 SMART
ZnF_C2H2 153 175 1.64e-1 SMART
ZnF_C2H2 181 203 2.05e-2 SMART
ZnF_C2H2 209 231 3.21e-4 SMART
ZnF_C2H2 250 273 5.42e-2 SMART
ZnF_C2H2 282 305 1.76e-1 SMART
ZnF_C2H2 310 332 8.67e-1 SMART
low complexity region 350 364 N/A INTRINSIC
ZnF_C2H2 396 420 1.16e-1 SMART
ZnF_C2H2 428 451 3.52e-1 SMART
ZnF_C2H2 467 490 7.9e-4 SMART
low complexity region 492 503 N/A INTRINSIC
ZnF_C2H2 504 527 2.53e-2 SMART
ZnF_C2H2 550 575 3.99e0 SMART
low complexity region 591 602 N/A INTRINSIC
ZnF_C2H2 619 641 3.16e-3 SMART
ZnF_C2H2 649 671 5.81e-2 SMART
ZnF_C2H2 679 702 4.87e-4 SMART
ZnF_C2H2 707 730 7.26e-3 SMART
ZnF_C2H2 737 760 4.79e-3 SMART
ZnF_C2H2 768 790 1.36e-2 SMART
ZnF_C2H2 794 817 4.72e-2 SMART
ZnF_C2H2 873 896 4.12e0 SMART
ZnF_C2H2 917 939 5.59e-4 SMART
ZnF_C2H2 946 968 6.42e-4 SMART
ZnF_C2H2 975 997 4.94e0 SMART
ZnF_C2H2 1007 1029 4.99e1 SMART
Pfam:zf-C2H2_6 1050 1068 1.6e-1 PFAM
ZnF_C2H2 1107 1130 1.12e-3 SMART
ZnF_C2H2 1155 1177 1.45e-2 SMART
ZnF_C2H2 1185 1207 5.72e-1 SMART
ZnF_C2H2 1216 1239 1.18e-2 SMART
ZnF_C2H2 1246 1269 4.05e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109655
AA Change: M335I

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000105282
Gene: ENSMUSG00000045333
AA Change: M335I

DomainStartEndE-ValueType
low complexity region 60 72 N/A INTRINSIC
ZnF_C2H2 75 96 5.07e0 SMART
low complexity region 128 144 N/A INTRINSIC
ZnF_C2H2 146 168 1.28e-3 SMART
ZnF_C2H2 174 196 1.64e-1 SMART
ZnF_C2H2 202 224 2.05e-2 SMART
ZnF_C2H2 230 252 3.21e-4 SMART
ZnF_C2H2 271 294 5.42e-2 SMART
ZnF_C2H2 303 326 1.76e-1 SMART
ZnF_C2H2 331 353 8.67e-1 SMART
low complexity region 371 385 N/A INTRINSIC
ZnF_C2H2 417 441 1.16e-1 SMART
ZnF_C2H2 449 472 3.52e-1 SMART
ZnF_C2H2 488 511 7.9e-4 SMART
low complexity region 513 524 N/A INTRINSIC
ZnF_C2H2 525 548 2.53e-2 SMART
ZnF_C2H2 571 596 3.99e0 SMART
low complexity region 612 623 N/A INTRINSIC
ZnF_C2H2 640 662 3.16e-3 SMART
ZnF_C2H2 670 692 5.81e-2 SMART
ZnF_C2H2 700 723 4.87e-4 SMART
ZnF_C2H2 728 751 7.26e-3 SMART
ZnF_C2H2 758 781 4.79e-3 SMART
ZnF_C2H2 789 811 1.36e-2 SMART
ZnF_C2H2 815 838 4.72e-2 SMART
ZnF_C2H2 894 917 4.12e0 SMART
ZnF_C2H2 938 960 5.59e-4 SMART
ZnF_C2H2 967 989 6.42e-4 SMART
ZnF_C2H2 996 1018 4.94e0 SMART
ZnF_C2H2 1028 1050 4.99e1 SMART
ZnF_C2H2 1128 1151 1.12e-3 SMART
ZnF_C2H2 1176 1198 1.45e-2 SMART
ZnF_C2H2 1206 1228 5.72e-1 SMART
ZnF_C2H2 1237 1260 1.18e-2 SMART
ZnF_C2H2 1267 1290 4.05e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165770
AA Change: M210I

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000129724
Gene: ENSMUSG00000045333
AA Change: M210I

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
ZnF_C2H2 21 43 1.28e-3 SMART
ZnF_C2H2 49 71 1.64e-1 SMART
ZnF_C2H2 77 99 2.05e-2 SMART
ZnF_C2H2 105 127 3.21e-4 SMART
ZnF_C2H2 146 169 5.42e-2 SMART
ZnF_C2H2 178 201 1.76e-1 SMART
ZnF_C2H2 206 228 8.67e-1 SMART
low complexity region 246 260 N/A INTRINSIC
ZnF_C2H2 292 316 1.16e-1 SMART
ZnF_C2H2 324 347 3.52e-1 SMART
ZnF_C2H2 363 386 7.9e-4 SMART
low complexity region 388 399 N/A INTRINSIC
ZnF_C2H2 400 423 2.53e-2 SMART
ZnF_C2H2 446 471 3.99e0 SMART
low complexity region 487 498 N/A INTRINSIC
ZnF_C2H2 515 537 3.16e-3 SMART
ZnF_C2H2 545 567 5.81e-2 SMART
ZnF_C2H2 575 598 4.87e-4 SMART
ZnF_C2H2 603 626 7.26e-3 SMART
ZnF_C2H2 633 656 4.79e-3 SMART
ZnF_C2H2 664 686 1.36e-2 SMART
ZnF_C2H2 690 713 4.72e-2 SMART
ZnF_C2H2 769 792 4.12e0 SMART
ZnF_C2H2 813 835 5.59e-4 SMART
ZnF_C2H2 842 864 6.42e-4 SMART
ZnF_C2H2 871 893 4.94e0 SMART
ZnF_C2H2 903 925 4.99e1 SMART
Pfam:zf-C2H2_6 946 964 2.5e-1 PFAM
ZnF_C2H2 1003 1026 1.12e-3 SMART
ZnF_C2H2 1051 1073 1.45e-2 SMART
ZnF_C2H2 1081 1103 5.72e-1 SMART
ZnF_C2H2 1112 1135 1.18e-2 SMART
ZnF_C2H2 1142 1165 4.05e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174249
SMART Domains Protein: ENSMUSP00000134103
Gene: ENSMUSG00000045333

DomainStartEndE-ValueType
low complexity region 60 76 N/A INTRINSIC
ZnF_C2H2 78 100 1.28e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174764
SMART Domains Protein: ENSMUSP00000134575
Gene: ENSMUSG00000045333

DomainStartEndE-ValueType
low complexity region 63 75 N/A INTRINSIC
ZnF_C2H2 78 99 5.07e0 SMART
low complexity region 131 147 N/A INTRINSIC
ZnF_C2H2 149 171 1.28e-3 SMART
ZnF_C2H2 177 199 1.64e-1 SMART
ZnF_C2H2 205 227 2.05e-2 SMART
Pfam:zf-C2H2_6 232 244 2.5e-1 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 93% (54/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear protein that belongs to the family of Kruppel-like C2H2 zinc finger proteins. It functions as a DNA-binding transcription factor by using distinct zinc fingers in different signaling pathways. Thus, it is thought that this gene may have multiple roles in signal transduction during development. Mutations in this gene are associated with nephronophthisis-14 and Joubert syndrome-19. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mutations in this gene lead to postnatal lethality, abnormal gait, ataxia, reduced body size, loss of the corpus callosum, reduction of the hippocampus, olfactory bulb defects, and variable malformation of the cerebellum, including vermis agenesis, due to reduced proliferation of neural precursors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik A G 4: 107,895,599 N152D unknown Het
1700021F05Rik A G 10: 43,532,937 L70S probably benign Het
Acsm3 T A 7: 119,775,169 S281R probably damaging Het
Adipor2 G T 6: 119,363,486 probably benign Het
Alk T C 17: 71,897,941 S1079G probably damaging Het
Ankrd27 T C 7: 35,602,584 probably null Het
Anxa6 C A 11: 55,001,282 E283* probably null Het
Bnc2 T C 4: 84,276,313 H858R possibly damaging Het
Btnl6 T C 17: 34,508,069 S496G probably benign Het
Ccdc88a T C 11: 29,460,860 S449P probably benign Het
Cdh23 A T 10: 60,410,910 D916E probably damaging Het
Cfap43 A T 19: 47,748,017 L1345H possibly damaging Het
Cyld A T 8: 88,729,510 H396L probably benign Het
Cyp20a1 A G 1: 60,379,420 T340A possibly damaging Het
Dera A T 6: 137,830,204 I217F probably damaging Het
Dnah11 A G 12: 118,190,804 L247P probably damaging Het
Eftud2 G A 11: 102,868,621 T152M probably damaging Het
Epb41l2 C T 10: 25,443,776 T169M probably benign Het
Fam186a T C 15: 99,947,142 D407G unknown Het
Fam189a2 T C 19: 23,988,494 K214E probably damaging Het
Gli3 T A 13: 15,715,034 C578S probably damaging Het
Gm436 G A 4: 144,670,113 R350C possibly damaging Het
Gm6408 A G 5: 146,482,427 N84S probably benign Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,887,919 probably benign Het
Herc2 C A 7: 56,188,613 T3296K probably damaging Het
Hnf4g A T 3: 3,643,073 probably benign Het
Hyal4 C A 6: 24,755,827 Q15K probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcna3 A G 3: 107,036,592 E57G probably damaging Het
Kcnc3 C A 7: 44,591,596 D237E probably benign Het
Map3k8 A G 18: 4,343,137 V130A probably benign Het
Mpp7 A G 18: 7,440,430 probably null Het
Myh13 T A 11: 67,342,485 L610Q probably damaging Het
Olfr1020 T A 2: 85,849,902 M150K probably benign Het
Olfr1339 C A 4: 118,735,038 P170T probably damaging Het
Olfr917 T C 9: 38,665,768 I25M probably benign Het
Pcdhb5 A T 18: 37,321,076 T170S probably benign Het
Polr3b T A 10: 84,680,387 H626Q probably benign Het
Prkg1 A T 19: 31,764,746 L26Q probably damaging Het
Prob1 T C 18: 35,653,986 N405S possibly damaging Het
Proz T G 8: 13,073,630 S300R probably damaging Het
Psg19 A G 7: 18,794,065 I251T probably benign Het
Rcbtb1 T C 14: 59,229,952 I413T possibly damaging Het
Rnf144b T A 13: 47,228,976 Y103N probably damaging Het
Rspry1 G C 8: 94,632,119 G194R probably benign Het
Scn2b A G 9: 45,125,619 I142V probably damaging Het
Spata20 A T 11: 94,481,781 L588H probably damaging Het
Stk32b T A 5: 37,457,159 H335L probably benign Het
Taar4 A C 10: 23,960,903 D137A possibly damaging Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tek A T 4: 94,849,837 H708L probably benign Het
Tmem89 C T 9: 108,915,027 L132F unknown Het
Ugt2b38 T C 5: 87,411,822 I404V probably benign Het
Vmn1r16 C T 6: 57,322,829 M269I probably benign Het
Vmn1r201 A G 13: 22,475,252 K212R probably damaging Het
Vmn2r11 A C 5: 109,053,760 F293V probably damaging Het
Zdhhc17 A T 10: 110,962,379 probably benign Het
Zfp74 T C 7: 29,934,654 Y543C probably damaging Het
Zfp975 A T 7: 42,662,840 S116R probably benign Het
Other mutations in Zfp423
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Zfp423 APN 8 87781611 splice site probably null
IGL01359:Zfp423 APN 8 87780662 missense probably damaging 1.00
IGL01780:Zfp423 APN 8 87781508 missense probably damaging 1.00
IGL02250:Zfp423 APN 8 87783255 missense probably damaging 1.00
IGL02301:Zfp423 APN 8 87781574 missense probably damaging 1.00
IGL02320:Zfp423 APN 8 87781602 missense probably damaging 1.00
IGL02804:Zfp423 APN 8 87782657 missense probably benign 0.02
IGL03090:Zfp423 APN 8 87781443 missense probably damaging 1.00
IGL03198:Zfp423 APN 8 87781676 missense possibly damaging 0.73
IGL03383:Zfp423 APN 8 87859452 nonsense probably null
swell UTSW 8 87686559 splice site probably null
R0110:Zfp423 UTSW 8 87782259 missense possibly damaging 0.60
R0142:Zfp423 UTSW 8 87780340 nonsense probably null
R0256:Zfp423 UTSW 8 87773634 nonsense probably null
R0538:Zfp423 UTSW 8 87782085 missense probably damaging 0.99
R0542:Zfp423 UTSW 8 87780609 missense probably damaging 1.00
R0614:Zfp423 UTSW 8 87782114 missense probably damaging 1.00
R1179:Zfp423 UTSW 8 87688072 missense probably damaging 0.97
R1417:Zfp423 UTSW 8 87773656 splice site probably null
R1429:Zfp423 UTSW 8 87686442 missense probably damaging 0.99
R1570:Zfp423 UTSW 8 87782558 missense probably benign 0.37
R2013:Zfp423 UTSW 8 87782397 missense probably benign 0.43
R2043:Zfp423 UTSW 8 87782618 missense probably damaging 1.00
R2064:Zfp423 UTSW 8 87781358 missense probably benign 0.04
R2108:Zfp423 UTSW 8 87781178 missense possibly damaging 0.73
R2358:Zfp423 UTSW 8 87780551 missense possibly damaging 0.56
R3177:Zfp423 UTSW 8 87782331 missense probably damaging 1.00
R3277:Zfp423 UTSW 8 87782331 missense probably damaging 1.00
R3738:Zfp423 UTSW 8 87781344 missense probably damaging 1.00
R3739:Zfp423 UTSW 8 87781344 missense probably damaging 1.00
R3773:Zfp423 UTSW 8 87780512 missense probably benign 0.03
R4034:Zfp423 UTSW 8 87781344 missense probably damaging 1.00
R4425:Zfp423 UTSW 8 87782973 missense probably damaging 1.00
R4611:Zfp423 UTSW 8 87688081 missense possibly damaging 0.90
R4700:Zfp423 UTSW 8 87781710 splice site probably null
R4753:Zfp423 UTSW 8 87781446 missense probably benign 0.00
R4818:Zfp423 UTSW 8 87904500 missense probably benign 0.00
R5026:Zfp423 UTSW 8 87780674 missense probably damaging 1.00
R5190:Zfp423 UTSW 8 87782463 missense probably damaging 1.00
R5243:Zfp423 UTSW 8 87773647 missense probably benign 0.03
R5284:Zfp423 UTSW 8 87781677 missense possibly damaging 0.73
R5586:Zfp423 UTSW 8 87859340 missense possibly damaging 0.93
R5601:Zfp423 UTSW 8 87782009 missense probably damaging 1.00
R5671:Zfp423 UTSW 8 87782327 missense probably damaging 0.99
R5717:Zfp423 UTSW 8 87686559 splice site probably null
R5801:Zfp423 UTSW 8 87859362 missense probably damaging 0.99
R5917:Zfp423 UTSW 8 87782232 nonsense probably null
R5985:Zfp423 UTSW 8 87782146 missense possibly damaging 0.83
R6111:Zfp423 UTSW 8 87782687 missense probably damaging 0.99
R6306:Zfp423 UTSW 8 87782034 missense possibly damaging 0.64
R6770:Zfp423 UTSW 8 87781817 missense probably damaging 0.99
R6970:Zfp423 UTSW 8 87803779 missense probably benign 0.00
R7029:Zfp423 UTSW 8 87688066 missense probably damaging 0.99
R7060:Zfp423 UTSW 8 87782879 missense probably damaging 1.00
R7074:Zfp423 UTSW 8 87782432 missense probably benign 0.00
R7121:Zfp423 UTSW 8 87780861 missense probably damaging 1.00
R7242:Zfp423 UTSW 8 87904527 missense probably benign 0.07
R7359:Zfp423 UTSW 8 87782243 missense possibly damaging 0.52
R7426:Zfp423 UTSW 8 87780713 missense probably damaging 1.00
R7540:Zfp423 UTSW 8 87688067 missense possibly damaging 0.95
R7640:Zfp423 UTSW 8 87781277 missense probably damaging 1.00
R7767:Zfp423 UTSW 8 87780884 missense probably damaging 1.00
R7938:Zfp423 UTSW 8 87895676 missense unknown
R7986:Zfp423 UTSW 8 87780350 missense probably benign 0.04
R8347:Zfp423 UTSW 8 87783156 missense probably damaging 0.99
R8356:Zfp423 UTSW 8 87783282 missense probably damaging 1.00
R8710:Zfp423 UTSW 8 87780921 missense possibly damaging 0.74
R8794:Zfp423 UTSW 8 87781229 missense probably damaging 1.00
R8832:Zfp423 UTSW 8 87781199 missense probably damaging 0.98
R9018:Zfp423 UTSW 8 87781753 missense probably benign 0.25
R9182:Zfp423 UTSW 8 87782114 missense probably damaging 0.99
R9309:Zfp423 UTSW 8 87783060 missense probably damaging 0.99
R9312:Zfp423 UTSW 8 87781941 missense probably damaging 1.00
Z1176:Zfp423 UTSW 8 87859420 missense possibly damaging 0.49
Z1177:Zfp423 UTSW 8 87780925 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATAGGGGCAGCTGTAGAC -3'
(R):5'- ACTGCGAGGATACCTTTAGCC -3'

Sequencing Primer
(F):5'- AGCTGTAGACGACCTTGGG -3'
(R):5'- CGAGGATACCTTTAGCCAGACAG -3'
Posted On 2021-03-08