Incidental Mutation 'R8676:Taar4'
ID 661395
Institutional Source Beutler Lab
Gene Symbol Taar4
Ensembl Gene ENSMUSG00000069707
Gene Name trace amine-associated receptor 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock # R8676 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 23960494-23961537 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 23960903 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 137 (D137A)
Ref Sequence ENSEMBL: ENSMUSP00000090330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092660]
AlphaFold Q5QD15
Predicted Effect possibly damaging
Transcript: ENSMUST00000092660
AA Change: D137A

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000090330
Gene: ENSMUSG00000069707
AA Change: D137A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 44 328 9.2e-11 PFAM
Pfam:7tm_1 50 313 4.6e-63 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 93% (54/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired olfactory response and aversion to PEA and puma urine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik A G 4: 107,895,599 N152D unknown Het
1700021F05Rik A G 10: 43,532,937 L70S probably benign Het
Acsm3 T A 7: 119,775,169 S281R probably damaging Het
Adipor2 G T 6: 119,363,486 probably benign Het
Alk T C 17: 71,897,941 S1079G probably damaging Het
Ankrd27 T C 7: 35,602,584 probably null Het
Anxa6 C A 11: 55,001,282 E283* probably null Het
Bnc2 T C 4: 84,276,313 H858R possibly damaging Het
Btnl6 T C 17: 34,508,069 S496G probably benign Het
Ccdc88a T C 11: 29,460,860 S449P probably benign Het
Cdh23 A T 10: 60,410,910 D916E probably damaging Het
Cfap43 A T 19: 47,748,017 L1345H possibly damaging Het
Cyld A T 8: 88,729,510 H396L probably benign Het
Cyp20a1 A G 1: 60,379,420 T340A possibly damaging Het
Dera A T 6: 137,830,204 I217F probably damaging Het
Dnah11 A G 12: 118,190,804 L247P probably damaging Het
Eftud2 G A 11: 102,868,621 T152M probably damaging Het
Epb41l2 C T 10: 25,443,776 T169M probably benign Het
Fam186a T C 15: 99,947,142 D407G unknown Het
Fam189a2 T C 19: 23,988,494 K214E probably damaging Het
Gli3 T A 13: 15,715,034 C578S probably damaging Het
Gm436 G A 4: 144,670,113 R350C possibly damaging Het
Gm6408 A G 5: 146,482,427 N84S probably benign Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,887,919 probably benign Het
Herc2 C A 7: 56,188,613 T3296K probably damaging Het
Hnf4g A T 3: 3,643,073 probably benign Het
Hyal4 C A 6: 24,755,827 Q15K probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcna3 A G 3: 107,036,592 E57G probably damaging Het
Kcnc3 C A 7: 44,591,596 D237E probably benign Het
Map3k8 A G 18: 4,343,137 V130A probably benign Het
Mpp7 A G 18: 7,440,430 probably null Het
Myh13 T A 11: 67,342,485 L610Q probably damaging Het
Olfr1020 T A 2: 85,849,902 M150K probably benign Het
Olfr1339 C A 4: 118,735,038 P170T probably damaging Het
Olfr917 T C 9: 38,665,768 I25M probably benign Het
Pcdhb5 A T 18: 37,321,076 T170S probably benign Het
Polr3b T A 10: 84,680,387 H626Q probably benign Het
Prkg1 A T 19: 31,764,746 L26Q probably damaging Het
Prob1 T C 18: 35,653,986 N405S possibly damaging Het
Proz T G 8: 13,073,630 S300R probably damaging Het
Psg19 A G 7: 18,794,065 I251T probably benign Het
Rcbtb1 T C 14: 59,229,952 I413T possibly damaging Het
Rnf144b T A 13: 47,228,976 Y103N probably damaging Het
Rspry1 G C 8: 94,632,119 G194R probably benign Het
Scn2b A G 9: 45,125,619 I142V probably damaging Het
Spata20 A T 11: 94,481,781 L588H probably damaging Het
Stk32b T A 5: 37,457,159 H335L probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tek A T 4: 94,849,837 H708L probably benign Het
Tmem89 C T 9: 108,915,027 L132F unknown Het
Ugt2b38 T C 5: 87,411,822 I404V probably benign Het
Vmn1r16 C T 6: 57,322,829 M269I probably benign Het
Vmn1r201 A G 13: 22,475,252 K212R probably damaging Het
Vmn2r11 A C 5: 109,053,760 F293V probably damaging Het
Zdhhc17 A T 10: 110,962,379 probably benign Het
Zfp423 C A 8: 87,782,710 M335I probably benign Het
Zfp74 T C 7: 29,934,654 Y543C probably damaging Het
Zfp975 A T 7: 42,662,840 S116R probably benign Het
Other mutations in Taar4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02576:Taar4 APN 10 23961011 missense probably damaging 1.00
IGL03202:Taar4 APN 10 23960794 missense probably damaging 1.00
I2288:Taar4 UTSW 10 23960920 missense probably benign 0.03
R0103:Taar4 UTSW 10 23961406 missense probably damaging 1.00
R0103:Taar4 UTSW 10 23961406 missense probably damaging 1.00
R0514:Taar4 UTSW 10 23960882 missense probably damaging 1.00
R1222:Taar4 UTSW 10 23961332 missense probably benign 0.05
R1248:Taar4 UTSW 10 23961038 missense possibly damaging 0.95
R1514:Taar4 UTSW 10 23960612 missense possibly damaging 0.71
R1921:Taar4 UTSW 10 23961341 missense probably damaging 1.00
R2074:Taar4 UTSW 10 23961173 missense probably benign 0.18
R2354:Taar4 UTSW 10 23961014 missense probably damaging 1.00
R2392:Taar4 UTSW 10 23961274 missense possibly damaging 0.94
R2698:Taar4 UTSW 10 23961430 missense probably damaging 1.00
R3902:Taar4 UTSW 10 23961015 missense probably damaging 1.00
R4688:Taar4 UTSW 10 23960833 missense probably damaging 1.00
R5495:Taar4 UTSW 10 23961283 missense possibly damaging 0.95
R5595:Taar4 UTSW 10 23960741 missense probably damaging 1.00
R5773:Taar4 UTSW 10 23961158 missense probably damaging 1.00
R7403:Taar4 UTSW 10 23961059 missense probably damaging 1.00
R7581:Taar4 UTSW 10 23961154 missense probably damaging 0.97
R7736:Taar4 UTSW 10 23960999 missense probably damaging 1.00
R7859:Taar4 UTSW 10 23961134 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- CTCCATGGCTACCACAGACTTC -3'
(R):5'- TATGAAGGAAGCCAGAACTCCC -3'

Sequencing Primer
(F):5'- CAGACTTCCTGTTGAGTTGCG -3'
(R):5'- GAACTCCCCAGAGCTTGTTAAATATC -3'
Posted On 2021-03-08