Incidental Mutation 'R8676:1700021F05Rik'
ID 661397
Institutional Source Beutler Lab
Gene Symbol 1700021F05Rik
Ensembl Gene ENSMUSG00000019797
Gene Name RIKEN cDNA 1700021F05 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock # R8676 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 43525133-43540994 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43532937 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 70 (L70S)
Ref Sequence ENSEMBL: ENSMUSP00000119053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000147196]
AlphaFold Q9CQF4
Predicted Effect probably benign
Transcript: ENSMUST00000147196
AA Change: L70S

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000119053
Gene: ENSMUSG00000019797
AA Change: L70S

DomainStartEndE-ValueType
low complexity region 84 96 N/A INTRINSIC
low complexity region 100 125 N/A INTRINSIC
Blast:S4 142 188 1e-19 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 93% (54/58)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik A G 4: 107,895,599 N152D unknown Het
Acsm3 T A 7: 119,775,169 S281R probably damaging Het
Adipor2 G T 6: 119,363,486 probably benign Het
Alk T C 17: 71,897,941 S1079G probably damaging Het
Ankrd27 T C 7: 35,602,584 probably null Het
Anxa6 C A 11: 55,001,282 E283* probably null Het
Bnc2 T C 4: 84,276,313 H858R possibly damaging Het
Btnl6 T C 17: 34,508,069 S496G probably benign Het
Ccdc88a T C 11: 29,460,860 S449P probably benign Het
Cdh23 A T 10: 60,410,910 D916E probably damaging Het
Cfap43 A T 19: 47,748,017 L1345H possibly damaging Het
Cyld A T 8: 88,729,510 H396L probably benign Het
Cyp20a1 A G 1: 60,379,420 T340A possibly damaging Het
Dera A T 6: 137,830,204 I217F probably damaging Het
Dnah11 A G 12: 118,190,804 L247P probably damaging Het
Eftud2 G A 11: 102,868,621 T152M probably damaging Het
Epb41l2 C T 10: 25,443,776 T169M probably benign Het
Fam186a T C 15: 99,947,142 D407G unknown Het
Fam189a2 T C 19: 23,988,494 K214E probably damaging Het
Gli3 T A 13: 15,715,034 C578S probably damaging Het
Gm436 G A 4: 144,670,113 R350C possibly damaging Het
Gm6408 A G 5: 146,482,427 N84S probably benign Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,887,919 probably benign Het
Herc2 C A 7: 56,188,613 T3296K probably damaging Het
Hnf4g A T 3: 3,643,073 probably benign Het
Hyal4 C A 6: 24,755,827 Q15K probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcna3 A G 3: 107,036,592 E57G probably damaging Het
Kcnc3 C A 7: 44,591,596 D237E probably benign Het
Map3k8 A G 18: 4,343,137 V130A probably benign Het
Mpp7 A G 18: 7,440,430 probably null Het
Myh13 T A 11: 67,342,485 L610Q probably damaging Het
Olfr1020 T A 2: 85,849,902 M150K probably benign Het
Olfr1339 C A 4: 118,735,038 P170T probably damaging Het
Olfr917 T C 9: 38,665,768 I25M probably benign Het
Pcdhb5 A T 18: 37,321,076 T170S probably benign Het
Polr3b T A 10: 84,680,387 H626Q probably benign Het
Prkg1 A T 19: 31,764,746 L26Q probably damaging Het
Prob1 T C 18: 35,653,986 N405S possibly damaging Het
Proz T G 8: 13,073,630 S300R probably damaging Het
Psg19 A G 7: 18,794,065 I251T probably benign Het
Rcbtb1 T C 14: 59,229,952 I413T possibly damaging Het
Rnf144b T A 13: 47,228,976 Y103N probably damaging Het
Rspry1 G C 8: 94,632,119 G194R probably benign Het
Scn2b A G 9: 45,125,619 I142V probably damaging Het
Spata20 A T 11: 94,481,781 L588H probably damaging Het
Stk32b T A 5: 37,457,159 H335L probably benign Het
Taar4 A C 10: 23,960,903 D137A possibly damaging Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tek A T 4: 94,849,837 H708L probably benign Het
Tmem89 C T 9: 108,915,027 L132F unknown Het
Ugt2b38 T C 5: 87,411,822 I404V probably benign Het
Vmn1r16 C T 6: 57,322,829 M269I probably benign Het
Vmn1r201 A G 13: 22,475,252 K212R probably damaging Het
Vmn2r11 A C 5: 109,053,760 F293V probably damaging Het
Zdhhc17 A T 10: 110,962,379 probably benign Het
Zfp423 C A 8: 87,782,710 M335I probably benign Het
Zfp74 T C 7: 29,934,654 Y543C probably damaging Het
Zfp975 A T 7: 42,662,840 S116R probably benign Het
Other mutations in 1700021F05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1531:1700021F05Rik UTSW 10 43525320 missense probably benign 0.01
R2497:1700021F05Rik UTSW 10 43525267 unclassified probably benign
R4280:1700021F05Rik UTSW 10 43532909 missense probably benign 0.03
R4574:1700021F05Rik UTSW 10 43533010 missense probably damaging 1.00
R5460:1700021F05Rik UTSW 10 43532865 missense probably benign 0.07
R5782:1700021F05Rik UTSW 10 43532903 missense probably benign 0.05
R6103:1700021F05Rik UTSW 10 43532920 missense probably benign 0.08
R6850:1700021F05Rik UTSW 10 43532725 small deletion probably benign
R6866:1700021F05Rik UTSW 10 43532725 small deletion probably benign
R6867:1700021F05Rik UTSW 10 43532725 small deletion probably benign
R6899:1700021F05Rik UTSW 10 43532784 missense possibly damaging 0.47
R7997:1700021F05Rik UTSW 10 43525360 missense probably benign 0.00
R8483:1700021F05Rik UTSW 10 43532919 missense probably benign 0.17
R8990:1700021F05Rik UTSW 10 43525237 missense unknown
X0022:1700021F05Rik UTSW 10 43525383 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGACTGCACCACCTTTTCC -3'
(R):5'- CTCACAGGTGCTCTAAGGAAG -3'

Sequencing Primer
(F):5'- GTAGTCCTTCGCCACACCAG -3'
(R):5'- CTCTAAGGAAGCCAGATGCCTG -3'
Posted On 2021-03-08