Incidental Mutation 'R8676:Spata20'
ID 661403
Institutional Source Beutler Lab
Gene Symbol Spata20
Ensembl Gene ENSMUSG00000020867
Gene Name spermatogenesis associated 20
Synonyms Tisp78
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock # R8676 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 94478904-94486179 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 94481781 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 588 (L588H)
Ref Sequence ENSEMBL: ENSMUSP00000042572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041705]
AlphaFold Q80YT5
Predicted Effect probably damaging
Transcript: ENSMUST00000041705
AA Change: L588H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042572
Gene: ENSMUSG00000020867
AA Change: L588H

DomainStartEndE-ValueType
Pfam:Thioredox_DsbH 66 228 2.9e-75 PFAM
Pfam:Thioredoxin_7 86 176 1.5e-13 PFAM
SCOP:d1fp3a_ 464 686 8e-48 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 93% (54/58)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik A G 4: 107,895,599 N152D unknown Het
1700021F05Rik A G 10: 43,532,937 L70S probably benign Het
Acsm3 T A 7: 119,775,169 S281R probably damaging Het
Adipor2 G T 6: 119,363,486 probably benign Het
Alk T C 17: 71,897,941 S1079G probably damaging Het
Ankrd27 T C 7: 35,602,584 probably null Het
Anxa6 C A 11: 55,001,282 E283* probably null Het
Bnc2 T C 4: 84,276,313 H858R possibly damaging Het
Btnl6 T C 17: 34,508,069 S496G probably benign Het
Ccdc88a T C 11: 29,460,860 S449P probably benign Het
Cdh23 A T 10: 60,410,910 D916E probably damaging Het
Cfap43 A T 19: 47,748,017 L1345H possibly damaging Het
Cyld A T 8: 88,729,510 H396L probably benign Het
Cyp20a1 A G 1: 60,379,420 T340A possibly damaging Het
Dera A T 6: 137,830,204 I217F probably damaging Het
Dnah11 A G 12: 118,190,804 L247P probably damaging Het
Eftud2 G A 11: 102,868,621 T152M probably damaging Het
Epb41l2 C T 10: 25,443,776 T169M probably benign Het
Fam186a T C 15: 99,947,142 D407G unknown Het
Fam189a2 T C 19: 23,988,494 K214E probably damaging Het
Gli3 T A 13: 15,715,034 C578S probably damaging Het
Gm436 G A 4: 144,670,113 R350C possibly damaging Het
Gm6408 A G 5: 146,482,427 N84S probably benign Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,887,919 probably benign Het
Herc2 C A 7: 56,188,613 T3296K probably damaging Het
Hnf4g A T 3: 3,643,073 probably benign Het
Hyal4 C A 6: 24,755,827 Q15K probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcna3 A G 3: 107,036,592 E57G probably damaging Het
Kcnc3 C A 7: 44,591,596 D237E probably benign Het
Map3k8 A G 18: 4,343,137 V130A probably benign Het
Mpp7 A G 18: 7,440,430 probably null Het
Myh13 T A 11: 67,342,485 L610Q probably damaging Het
Olfr1020 T A 2: 85,849,902 M150K probably benign Het
Olfr1339 C A 4: 118,735,038 P170T probably damaging Het
Olfr917 T C 9: 38,665,768 I25M probably benign Het
Pcdhb5 A T 18: 37,321,076 T170S probably benign Het
Polr3b T A 10: 84,680,387 H626Q probably benign Het
Prkg1 A T 19: 31,764,746 L26Q probably damaging Het
Prob1 T C 18: 35,653,986 N405S possibly damaging Het
Proz T G 8: 13,073,630 S300R probably damaging Het
Psg19 A G 7: 18,794,065 I251T probably benign Het
Rcbtb1 T C 14: 59,229,952 I413T possibly damaging Het
Rnf144b T A 13: 47,228,976 Y103N probably damaging Het
Rspry1 G C 8: 94,632,119 G194R probably benign Het
Scn2b A G 9: 45,125,619 I142V probably damaging Het
Stk32b T A 5: 37,457,159 H335L probably benign Het
Taar4 A C 10: 23,960,903 D137A possibly damaging Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tek A T 4: 94,849,837 H708L probably benign Het
Tmem89 C T 9: 108,915,027 L132F unknown Het
Ugt2b38 T C 5: 87,411,822 I404V probably benign Het
Vmn1r16 C T 6: 57,322,829 M269I probably benign Het
Vmn1r201 A G 13: 22,475,252 K212R probably damaging Het
Vmn2r11 A C 5: 109,053,760 F293V probably damaging Het
Zdhhc17 A T 10: 110,962,379 probably benign Het
Zfp423 C A 8: 87,782,710 M335I probably benign Het
Zfp74 T C 7: 29,934,654 Y543C probably damaging Het
Zfp975 A T 7: 42,662,840 S116R probably benign Het
Other mutations in Spata20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Spata20 APN 11 94479117 missense probably damaging 1.00
IGL01123:Spata20 APN 11 94483395 missense probably benign
IGL02008:Spata20 APN 11 94483463 missense probably damaging 1.00
PIT4458001:Spata20 UTSW 11 94484608 missense probably damaging 1.00
R0136:Spata20 UTSW 11 94480609 missense probably damaging 1.00
R0243:Spata20 UTSW 11 94481646 missense probably benign
R0557:Spata20 UTSW 11 94485222 missense probably benign 0.00
R0657:Spata20 UTSW 11 94480609 missense probably damaging 1.00
R1712:Spata20 UTSW 11 94480514 missense probably benign
R2166:Spata20 UTSW 11 94479104 missense probably benign 0.25
R4298:Spata20 UTSW 11 94483088 missense probably damaging 0.99
R4740:Spata20 UTSW 11 94484578 missense possibly damaging 0.94
R4791:Spata20 UTSW 11 94484586 missense probably damaging 0.99
R4980:Spata20 UTSW 11 94484609 missense probably damaging 1.00
R5894:Spata20 UTSW 11 94483618 missense probably damaging 0.98
R6373:Spata20 UTSW 11 94483400 missense probably benign
R7400:Spata20 UTSW 11 94483400 missense probably benign
R7439:Spata20 UTSW 11 94484041 missense probably benign 0.02
R7441:Spata20 UTSW 11 94484041 missense probably benign 0.02
R7562:Spata20 UTSW 11 94482553 missense probably benign 0.31
R7974:Spata20 UTSW 11 94484140 missense possibly damaging 0.66
R8036:Spata20 UTSW 11 94479137 missense probably benign 0.17
R8060:Spata20 UTSW 11 94482239 missense probably benign
R8335:Spata20 UTSW 11 94482543 missense probably benign 0.05
R8447:Spata20 UTSW 11 94482254 missense probably damaging 1.00
Z1176:Spata20 UTSW 11 94480535 missense probably benign 0.45
Z1177:Spata20 UTSW 11 94483139 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGTATCTTCCTCTGGGATGCCC -3'
(R):5'- GGCCCATTGACTCTTTTGGG -3'

Sequencing Primer
(F):5'- CAGGGCCCAAGACCAATG -3'
(R):5'- CCCATTGACTCTTTTGGGAAATGGAC -3'
Posted On 2021-03-08