Incidental Mutation 'R8676:Eftud2'
ID 661404
Institutional Source Beutler Lab
Gene Symbol Eftud2
Ensembl Gene ENSMUSG00000020929
Gene Name elongation factor Tu GTP binding domain containing 2
Synonyms 116kDa, Snrp116, U5-116kD
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8676 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 102838473-102880985 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 102868621 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 152 (T152M)
Ref Sequence ENSEMBL: ENSMUSP00000102675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021306] [ENSMUST00000107060] [ENSMUST00000138483] [ENSMUST00000173679]
AlphaFold O08810
Predicted Effect probably damaging
Transcript: ENSMUST00000021306
AA Change: T153M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021306
Gene: ENSMUSG00000020929
AA Change: T153M

DomainStartEndE-ValueType
Pfam:EFTUD2 3 110 1.1e-42 PFAM
Pfam:GTP_EFTU 127 440 9.6e-47 PFAM
Pfam:GTP_EFTU_D2 489 566 3.8e-15 PFAM
Pfam:EFG_II 584 656 9.9e-11 PFAM
EFG_IV 703 824 1.1e-16 SMART
EFG_C 826 915 1.14e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107060
AA Change: T152M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102675
Gene: ENSMUSG00000020929
AA Change: T152M

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 32 50 N/A INTRINSIC
Pfam:GTP_EFTU 126 439 9.6e-44 PFAM
Pfam:Miro 130 260 2.5e-6 PFAM
Pfam:GTP_EFTU_D2 488 565 7.9e-13 PFAM
Pfam:EFG_II 583 655 8.2e-10 PFAM
EFG_IV 702 823 1.1e-16 SMART
EFG_C 825 914 1.14e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138483
Predicted Effect probably damaging
Transcript: ENSMUST00000173679
AA Change: T143M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134327
Gene: ENSMUSG00000020929
AA Change: T143M

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 29 51 N/A INTRINSIC
Pfam:GTP_EFTU 127 430 2.2e-36 PFAM
Pfam:GTP_EFTU_D2 479 556 7.8e-13 PFAM
Pfam:EFG_II 574 646 8.1e-10 PFAM
EFG_IV 693 814 1.1e-16 SMART
EFG_C 816 905 1.14e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 93% (54/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase which is a component of the spliceosome complex which processes precursor mRNAs to produce mature mRNAs. Mutations in this gene are associated with mandibulofacial dysostosis with microcephaly. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik A G 4: 107,895,599 N152D unknown Het
1700021F05Rik A G 10: 43,532,937 L70S probably benign Het
Acsm3 T A 7: 119,775,169 S281R probably damaging Het
Adipor2 G T 6: 119,363,486 probably benign Het
Alk T C 17: 71,897,941 S1079G probably damaging Het
Ankrd27 T C 7: 35,602,584 probably null Het
Anxa6 C A 11: 55,001,282 E283* probably null Het
Bnc2 T C 4: 84,276,313 H858R possibly damaging Het
Btnl6 T C 17: 34,508,069 S496G probably benign Het
Ccdc88a T C 11: 29,460,860 S449P probably benign Het
Cdh23 A T 10: 60,410,910 D916E probably damaging Het
Cfap43 A T 19: 47,748,017 L1345H possibly damaging Het
Cyld A T 8: 88,729,510 H396L probably benign Het
Cyp20a1 A G 1: 60,379,420 T340A possibly damaging Het
Dera A T 6: 137,830,204 I217F probably damaging Het
Dnah11 A G 12: 118,190,804 L247P probably damaging Het
Epb41l2 C T 10: 25,443,776 T169M probably benign Het
Fam186a T C 15: 99,947,142 D407G unknown Het
Fam189a2 T C 19: 23,988,494 K214E probably damaging Het
Gli3 T A 13: 15,715,034 C578S probably damaging Het
Gm436 G A 4: 144,670,113 R350C possibly damaging Het
Gm6408 A G 5: 146,482,427 N84S probably benign Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,887,919 probably benign Het
Herc2 C A 7: 56,188,613 T3296K probably damaging Het
Hnf4g A T 3: 3,643,073 probably benign Het
Hyal4 C A 6: 24,755,827 Q15K probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcna3 A G 3: 107,036,592 E57G probably damaging Het
Kcnc3 C A 7: 44,591,596 D237E probably benign Het
Map3k8 A G 18: 4,343,137 V130A probably benign Het
Mpp7 A G 18: 7,440,430 probably null Het
Myh13 T A 11: 67,342,485 L610Q probably damaging Het
Olfr1020 T A 2: 85,849,902 M150K probably benign Het
Olfr1339 C A 4: 118,735,038 P170T probably damaging Het
Olfr917 T C 9: 38,665,768 I25M probably benign Het
Pcdhb5 A T 18: 37,321,076 T170S probably benign Het
Polr3b T A 10: 84,680,387 H626Q probably benign Het
Prkg1 A T 19: 31,764,746 L26Q probably damaging Het
Prob1 T C 18: 35,653,986 N405S possibly damaging Het
Proz T G 8: 13,073,630 S300R probably damaging Het
Psg19 A G 7: 18,794,065 I251T probably benign Het
Rcbtb1 T C 14: 59,229,952 I413T possibly damaging Het
Rnf144b T A 13: 47,228,976 Y103N probably damaging Het
Rspry1 G C 8: 94,632,119 G194R probably benign Het
Scn2b A G 9: 45,125,619 I142V probably damaging Het
Spata20 A T 11: 94,481,781 L588H probably damaging Het
Stk32b T A 5: 37,457,159 H335L probably benign Het
Taar4 A C 10: 23,960,903 D137A possibly damaging Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tek A T 4: 94,849,837 H708L probably benign Het
Tmem89 C T 9: 108,915,027 L132F unknown Het
Ugt2b38 T C 5: 87,411,822 I404V probably benign Het
Vmn1r16 C T 6: 57,322,829 M269I probably benign Het
Vmn1r201 A G 13: 22,475,252 K212R probably damaging Het
Vmn2r11 A C 5: 109,053,760 F293V probably damaging Het
Zdhhc17 A T 10: 110,962,379 probably benign Het
Zfp423 C A 8: 87,782,710 M335I probably benign Het
Zfp74 T C 7: 29,934,654 Y543C probably damaging Het
Zfp975 A T 7: 42,662,840 S116R probably benign Het
Other mutations in Eftud2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Eftud2 APN 11 102865563 splice site probably benign
IGL01765:Eftud2 APN 11 102839256 missense probably damaging 0.99
IGL01868:Eftud2 APN 11 102869127 missense probably benign 0.08
IGL02161:Eftud2 APN 11 102854876 splice site probably benign
IGL02165:Eftud2 APN 11 102851747 splice site probably benign
IGL02218:Eftud2 APN 11 102870213 missense possibly damaging 0.46
IGL02386:Eftud2 APN 11 102851754 splice site probably null
IGL02664:Eftud2 APN 11 102841712 missense probably damaging 1.00
IGL02677:Eftud2 APN 11 102846614 missense probably damaging 1.00
IGL02792:Eftud2 APN 11 102870256 splice site probably benign
IGL02870:Eftud2 APN 11 102862626 missense probably damaging 0.97
IGL03131:Eftud2 APN 11 102870183 missense probably damaging 1.00
R0137:Eftud2 UTSW 11 102868617 missense possibly damaging 0.94
R0244:Eftud2 UTSW 11 102864725 missense probably damaging 0.97
R0358:Eftud2 UTSW 11 102864801 splice site probably benign
R0463:Eftud2 UTSW 11 102864771 missense probably damaging 1.00
R0511:Eftud2 UTSW 11 102844222 missense probably damaging 1.00
R0525:Eftud2 UTSW 11 102839253 missense probably damaging 1.00
R0586:Eftud2 UTSW 11 102846620 missense probably damaging 1.00
R0751:Eftud2 UTSW 11 102839253 missense probably damaging 1.00
R1034:Eftud2 UTSW 11 102849184 missense probably benign
R1079:Eftud2 UTSW 11 102840044 nonsense probably null
R1208:Eftud2 UTSW 11 102864766 missense probably benign 0.22
R1208:Eftud2 UTSW 11 102864766 missense probably benign 0.22
R1220:Eftud2 UTSW 11 102851747 splice site probably benign
R1438:Eftud2 UTSW 11 102860042 missense probably damaging 1.00
R1520:Eftud2 UTSW 11 102839440 missense probably damaging 1.00
R1569:Eftud2 UTSW 11 102854771 splice site probably benign
R2270:Eftud2 UTSW 11 102864781 missense probably damaging 1.00
R3500:Eftud2 UTSW 11 102844180 missense probably damaging 1.00
R3686:Eftud2 UTSW 11 102844201 missense probably damaging 1.00
R3687:Eftud2 UTSW 11 102844201 missense probably damaging 1.00
R3688:Eftud2 UTSW 11 102844201 missense probably damaging 1.00
R3808:Eftud2 UTSW 11 102841463 splice site probably null
R3892:Eftud2 UTSW 11 102846187 missense probably damaging 0.99
R4003:Eftud2 UTSW 11 102860110 missense possibly damaging 0.51
R4091:Eftud2 UTSW 11 102839416 splice site probably null
R4794:Eftud2 UTSW 11 102870177 missense probably benign 0.14
R4841:Eftud2 UTSW 11 102854814 missense probably damaging 1.00
R4842:Eftud2 UTSW 11 102854814 missense probably damaging 1.00
R5151:Eftud2 UTSW 11 102867844 critical splice donor site probably null
R5208:Eftud2 UTSW 11 102841185 missense probably damaging 1.00
R6199:Eftud2 UTSW 11 102840057 missense probably damaging 1.00
R6357:Eftud2 UTSW 11 102864780 missense probably damaging 1.00
R6720:Eftud2 UTSW 11 102838623 nonsense probably null
R7604:Eftud2 UTSW 11 102848012 missense possibly damaging 0.87
R7886:Eftud2 UTSW 11 102840108 missense probably damaging 1.00
R8017:Eftud2 UTSW 11 102843348 critical splice donor site probably null
R8019:Eftud2 UTSW 11 102843348 critical splice donor site probably null
R8139:Eftud2 UTSW 11 102867859 missense probably benign 0.04
R8431:Eftud2 UTSW 11 102846236 missense probably benign 0.08
R8545:Eftud2 UTSW 11 102840271 missense probably damaging 1.00
R9089:Eftud2 UTSW 11 102869145 missense probably benign
R9173:Eftud2 UTSW 11 102843416 missense probably damaging 1.00
R9277:Eftud2 UTSW 11 102860029 missense probably damaging 1.00
R9313:Eftud2 UTSW 11 102839436 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGGATCCCAAATGCAGAACG -3'
(R):5'- GTGTTAATCCTTTGCTGTCCCATAG -3'

Sequencing Primer
(F):5'- ATGCAGGTTAACATCCTCCATG -3'
(R):5'- AATCCTTTGCTGTCCCATAGTTCTC -3'
Posted On 2021-03-08