Incidental Mutation 'R8676:Rnf144b'
ID 661409
Institutional Source Beutler Lab
Gene Symbol Rnf144b
Ensembl Gene ENSMUSG00000038068
Gene Name ring finger protein 144B
Synonyms Ibrdc2, E130105P19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8676 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 47122656-47247991 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 47228976 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 103 (Y103N)
Ref Sequence ENSEMBL: ENSMUSP00000071017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068891] [ENSMUST00000110111]
AlphaFold Q8BKD6
Predicted Effect probably damaging
Transcript: ENSMUST00000068891
AA Change: Y103N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071017
Gene: ENSMUSG00000038068
AA Change: Y103N

DomainStartEndE-ValueType
RING 30 78 2.24e0 SMART
IBR 101 166 2.16e-16 SMART
IBR 172 238 1.3e0 SMART
RING 191 283 6.17e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110111
AA Change: Y103N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105738
Gene: ENSMUSG00000038068
AA Change: Y103N

DomainStartEndE-ValueType
RING 30 78 2.24e0 SMART
IBR 101 166 2.16e-16 SMART
IBR 172 238 1.3e0 SMART
RING 191 283 6.17e-2 SMART
Meta Mutation Damage Score 0.8673 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 93% (54/58)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik A G 4: 107,895,599 N152D unknown Het
1700021F05Rik A G 10: 43,532,937 L70S probably benign Het
Acsm3 T A 7: 119,775,169 S281R probably damaging Het
Adipor2 G T 6: 119,363,486 probably benign Het
Alk T C 17: 71,897,941 S1079G probably damaging Het
Ankrd27 T C 7: 35,602,584 probably null Het
Anxa6 C A 11: 55,001,282 E283* probably null Het
Bnc2 T C 4: 84,276,313 H858R possibly damaging Het
Btnl6 T C 17: 34,508,069 S496G probably benign Het
Ccdc88a T C 11: 29,460,860 S449P probably benign Het
Cdh23 A T 10: 60,410,910 D916E probably damaging Het
Cfap43 A T 19: 47,748,017 L1345H possibly damaging Het
Cyld A T 8: 88,729,510 H396L probably benign Het
Cyp20a1 A G 1: 60,379,420 T340A possibly damaging Het
Dera A T 6: 137,830,204 I217F probably damaging Het
Dnah11 A G 12: 118,190,804 L247P probably damaging Het
Eftud2 G A 11: 102,868,621 T152M probably damaging Het
Epb41l2 C T 10: 25,443,776 T169M probably benign Het
Fam186a T C 15: 99,947,142 D407G unknown Het
Fam189a2 T C 19: 23,988,494 K214E probably damaging Het
Gli3 T A 13: 15,715,034 C578S probably damaging Het
Gm436 G A 4: 144,670,113 R350C possibly damaging Het
Gm6408 A G 5: 146,482,427 N84S probably benign Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,887,919 probably benign Het
Herc2 C A 7: 56,188,613 T3296K probably damaging Het
Hnf4g A T 3: 3,643,073 probably benign Het
Hyal4 C A 6: 24,755,827 Q15K probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcna3 A G 3: 107,036,592 E57G probably damaging Het
Kcnc3 C A 7: 44,591,596 D237E probably benign Het
Map3k8 A G 18: 4,343,137 V130A probably benign Het
Mpp7 A G 18: 7,440,430 probably null Het
Myh13 T A 11: 67,342,485 L610Q probably damaging Het
Olfr1020 T A 2: 85,849,902 M150K probably benign Het
Olfr1339 C A 4: 118,735,038 P170T probably damaging Het
Olfr917 T C 9: 38,665,768 I25M probably benign Het
Pcdhb5 A T 18: 37,321,076 T170S probably benign Het
Polr3b T A 10: 84,680,387 H626Q probably benign Het
Prkg1 A T 19: 31,764,746 L26Q probably damaging Het
Prob1 T C 18: 35,653,986 N405S possibly damaging Het
Proz T G 8: 13,073,630 S300R probably damaging Het
Psg19 A G 7: 18,794,065 I251T probably benign Het
Rcbtb1 T C 14: 59,229,952 I413T possibly damaging Het
Rspry1 G C 8: 94,632,119 G194R probably benign Het
Scn2b A G 9: 45,125,619 I142V probably damaging Het
Spata20 A T 11: 94,481,781 L588H probably damaging Het
Stk32b T A 5: 37,457,159 H335L probably benign Het
Taar4 A C 10: 23,960,903 D137A possibly damaging Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tek A T 4: 94,849,837 H708L probably benign Het
Tmem89 C T 9: 108,915,027 L132F unknown Het
Ugt2b38 T C 5: 87,411,822 I404V probably benign Het
Vmn1r16 C T 6: 57,322,829 M269I probably benign Het
Vmn1r201 A G 13: 22,475,252 K212R probably damaging Het
Vmn2r11 A C 5: 109,053,760 F293V probably damaging Het
Zdhhc17 A T 10: 110,962,379 probably benign Het
Zfp423 C A 8: 87,782,710 M335I probably benign Het
Zfp74 T C 7: 29,934,654 Y543C probably damaging Het
Zfp975 A T 7: 42,662,840 S116R probably benign Het
Other mutations in Rnf144b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Rnf144b APN 13 47220488 splice site probably benign
IGL00987:Rnf144b APN 13 47207493 missense possibly damaging 0.57
IGL02712:Rnf144b APN 13 47239779 missense probably damaging 1.00
IGL03002:Rnf144b APN 13 47242883 missense probably damaging 1.00
R0418:Rnf144b UTSW 13 47244490 missense probably benign 0.00
R0464:Rnf144b UTSW 13 47242887 nonsense probably null
R0652:Rnf144b UTSW 13 47220507 missense probably damaging 1.00
R0932:Rnf144b UTSW 13 47220525 missense probably null 0.44
R1472:Rnf144b UTSW 13 47242885 missense probably damaging 1.00
R2341:Rnf144b UTSW 13 47220500 missense probably benign 0.05
R4306:Rnf144b UTSW 13 47242942 missense probably damaging 1.00
R4308:Rnf144b UTSW 13 47242942 missense probably damaging 1.00
R4523:Rnf144b UTSW 13 47207537 missense probably benign 0.08
R5591:Rnf144b UTSW 13 47242954 critical splice donor site probably null
R7323:Rnf144b UTSW 13 47239782 missense probably damaging 1.00
R7887:Rnf144b UTSW 13 47239811 missense probably damaging 1.00
R9159:Rnf144b UTSW 13 47242872 missense probably damaging 1.00
X0064:Rnf144b UTSW 13 47237464 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAACTTCATCACTGATGGGG -3'
(R):5'- GTGCCAATTGCTGTTTCCAC -3'

Sequencing Primer
(F):5'- CATGTGTTGCTGCATGATCAAG -3'
(R):5'- AATTGCTGTTTCCACTCCTTGCAG -3'
Posted On 2021-03-08