Incidental Mutation 'R8677:Ptprc'
ID 661422
Institutional Source Beutler Lab
Gene Symbol Ptprc
Ensembl Gene ENSMUSG00000026395
Gene Name protein tyrosine phosphatase receptor type C
Synonyms Ly-5, T200, CD45, B220, Lyt-4
MMRRC Submission 068532-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8677 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 137990599-138103446 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 138011335 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 598 (I598T)
Ref Sequence ENSEMBL: ENSMUSP00000138800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182283] [ENSMUST00000182755] [ENSMUST00000183301]
AlphaFold P06800
Predicted Effect probably damaging
Transcript: ENSMUST00000182283
AA Change: I598T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138800
Gene: ENSMUSG00000026395
AA Change: I598T

DomainStartEndE-ValueType
Pfam:PTP_N 7 32 4.2e-13 PFAM
low complexity region 33 66 N/A INTRINSIC
Pfam:CD45 72 131 2.3e-24 PFAM
FN3 235 319 2.28e0 SMART
FN3 335 413 3.48e-1 SMART
transmembrane domain 428 449 N/A INTRINSIC
PTPc 502 764 7.57e-127 SMART
PTPc 793 1079 1.39e-102 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182755
AA Change: I574T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138275
Gene: ENSMUSG00000026395
AA Change: I574T

DomainStartEndE-ValueType
Pfam:PTP_N 7 34 5.5e-13 PFAM
Pfam:CD45 48 107 2.3e-24 PFAM
FN3 211 295 2.28e0 SMART
FN3 311 389 3.48e-1 SMART
transmembrane domain 404 425 N/A INTRINSIC
PTPc 478 740 7.57e-127 SMART
PTPc 769 1055 1.39e-102 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000138350
Gene: ENSMUSG00000026395
AA Change: I737T

DomainStartEndE-ValueType
Pfam:PTP_N 7 33 2.7e-13 PFAM
low complexity region 111 128 N/A INTRINSIC
low complexity region 170 205 N/A INTRINSIC
Pfam:CD45 211 270 2.1e-24 PFAM
FN3 374 458 2.28e0 SMART
FN3 474 552 3.48e-1 SMART
transmembrane domain 567 588 N/A INTRINSIC
PTPc 641 903 7.57e-127 SMART
PTPc 932 1218 1.39e-102 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitosis, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus is classified as a receptor type PTP. This PTP has been shown to be an essential regulator of T- and B-cell antigen receptor signaling. It functions through either direct interaction with components of the antigen receptor complexes, or by activating various Src family kinases required for the antigen receptor signaling. This PTP also suppresses JAK kinases, and thus functions as a regulator of cytokine receptor signaling. Alternatively spliced transcripts variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous null mutants have defective T cell, B cell, and NK cell morphology and physiology. Mice carrying an engineered point mutation exhibit lymphoproliferation and autoimmunity that leads to premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acd A C 8: 106,427,576 (GRCm39) S25R probably damaging Het
Acly A T 11: 100,410,569 (GRCm39) H136Q probably damaging Het
Adrm1 C T 2: 179,813,832 (GRCm39) T2M probably benign Het
Ankrd12 A T 17: 66,331,209 (GRCm39) L246M probably damaging Het
Bltp2 C T 11: 78,174,982 (GRCm39) R1706C probably damaging Het
Cacnb3 T C 15: 98,539,931 (GRCm39) L258P probably damaging Het
Cd36 C T 5: 18,025,493 (GRCm39) V76M probably damaging Het
Cep120 A G 18: 53,871,633 (GRCm39) F80L possibly damaging Het
Clcn1 A T 6: 42,267,519 (GRCm39) probably null Het
Col17a1 T C 19: 47,640,240 (GRCm39) T1042A probably benign Het
Comp A T 8: 70,832,910 (GRCm39) N623Y probably damaging Het
Ctnnal1 A G 4: 56,813,272 (GRCm39) L653P probably benign Het
Cx3cl1 G T 8: 95,506,443 (GRCm39) R149S probably benign Het
Dbndd2 T A 2: 164,330,522 (GRCm39) N58K probably damaging Het
Dclk1 A G 3: 55,409,840 (GRCm39) I595V probably damaging Het
Dhx15 T C 5: 52,341,886 (GRCm39) D144G probably benign Het
Dlat T C 9: 50,570,007 (GRCm39) E120G probably damaging Het
Fam171a1 T A 2: 3,221,352 (GRCm39) Y273N probably damaging Het
Fndc3b A T 3: 27,511,176 (GRCm39) V778D probably benign Het
Grn T C 11: 102,324,393 (GRCm39) S129P possibly damaging Het
Grxcr1 T C 5: 68,267,757 (GRCm39) F169L possibly damaging Het
Hcn2 A G 10: 79,560,619 (GRCm39) I317V probably benign Het
Heca T C 10: 17,791,424 (GRCm39) N211D probably benign Het
Htr1f T C 16: 64,746,414 (GRCm39) T293A possibly damaging Het
Ifitm10 T A 7: 141,909,749 (GRCm39) I116F probably benign Het
Itprid1 A G 6: 55,849,579 (GRCm39) H37R probably benign Het
Ivl A T 3: 92,479,986 (GRCm39) D26E probably benign Het
Kcnma1 T A 14: 23,436,418 (GRCm39) E761V probably benign Het
Ltbp1 G T 17: 75,655,753 (GRCm39) V923F probably benign Het
Mfsd4b2 A T 10: 39,799,805 (GRCm39) F32L probably benign Het
Micu2 T C 14: 58,161,420 (GRCm39) R301G possibly damaging Het
Miip C T 4: 147,947,503 (GRCm39) C219Y probably damaging Het
Mn1 T A 5: 111,566,885 (GRCm39) L285* probably null Het
Mthfd1l T A 10: 3,998,250 (GRCm39) N664K possibly damaging Het
Mttp A T 3: 137,810,437 (GRCm39) H659Q probably benign Het
Myadml2 G A 11: 120,538,815 (GRCm39) P7S probably benign Het
Nlgn3 T C X: 100,352,390 (GRCm39) V179A probably damaging Het
Nlrp4c C T 7: 6,075,644 (GRCm39) T645I probably damaging Het
Notch1 C T 2: 26,359,936 (GRCm39) V1260I probably damaging Het
Numa1 T C 7: 101,650,148 (GRCm39) L1293P probably damaging Het
Or1a1 A T 11: 74,086,415 (GRCm39) I29F probably benign Het
Or56a4 A G 7: 104,806,775 (GRCm39) L38P probably benign Het
Pcdh12 G T 18: 38,415,191 (GRCm39) H645N probably benign Het
Pdcd1 A T 1: 93,968,952 (GRCm39) L122H probably damaging Het
Pknox2 G A 9: 36,821,887 (GRCm39) P246L probably damaging Het
Polr2a A T 11: 69,626,381 (GRCm39) S1590T possibly damaging Het
Ppp1r16b G A 2: 158,593,098 (GRCm39) D226N probably damaging Het
Proser1 A G 3: 53,385,122 (GRCm39) T335A probably benign Het
Rasal3 T C 17: 32,615,828 (GRCm39) T337A probably benign Het
Rasgrp3 A T 17: 75,819,055 (GRCm39) T415S probably benign Het
Rbm7 T A 9: 48,401,273 (GRCm39) R152* probably null Het
Sanbr T C 11: 23,545,471 (GRCm39) D474G probably benign Het
Sf3b2 C T 19: 5,336,257 (GRCm39) R513H probably damaging Het
Slc22a30 A G 19: 8,364,035 (GRCm39) S214P probably benign Het
Spam1 A G 6: 24,796,984 (GRCm39) T312A probably benign Het
Ssh2 A G 11: 77,346,019 (GRCm39) T1335A possibly damaging Het
Tef T A 15: 81,699,169 (GRCm39) L59Q probably damaging Het
Tmem131l A C 3: 83,836,009 (GRCm39) V700G probably damaging Het
Twsg1 A G 17: 66,233,402 (GRCm39) S183P probably damaging Het
Unc13c T C 9: 73,840,243 (GRCm39) T203A probably benign Het
Uqcc6 G T 10: 82,456,050 (GRCm39) T37K possibly damaging Het
Vmn2r75 G T 7: 85,814,410 (GRCm39) P361Q possibly damaging Het
Xirp2 A T 2: 67,346,978 (GRCm39) N3073I probably damaging Het
Zfp114 A G 7: 23,880,070 (GRCm39) N140D probably benign Het
Other mutations in Ptprc
AlleleSourceChrCoordTypePredicted EffectPPH Score
lochy APN 1 138,011,528 (GRCm39) splice site probably benign
IGL00486:Ptprc APN 1 138,043,359 (GRCm39) missense probably damaging 0.97
IGL00771:Ptprc APN 1 138,041,415 (GRCm39) missense probably benign 0.00
IGL00833:Ptprc APN 1 138,006,230 (GRCm39) missense possibly damaging 0.55
IGL00919:Ptprc APN 1 138,041,380 (GRCm39) missense probably damaging 1.00
IGL01020:Ptprc APN 1 138,047,911 (GRCm39) critical splice acceptor site probably null 0.00
IGL01024:Ptprc APN 1 138,008,650 (GRCm39) missense probably damaging 1.00
IGL01302:Ptprc APN 1 138,027,369 (GRCm39) missense possibly damaging 0.82
IGL01548:Ptprc APN 1 138,027,219 (GRCm39) critical splice donor site probably null 0.00
IGL01620:Ptprc APN 1 137,996,148 (GRCm39) missense possibly damaging 0.88
IGL01775:Ptprc APN 1 137,992,497 (GRCm39) missense probably damaging 1.00
IGL01820:Ptprc APN 1 137,993,936 (GRCm39) missense probably damaging 1.00
IGL02340:Ptprc APN 1 137,998,957 (GRCm39) missense probably damaging 1.00
IGL02943:Ptprc APN 1 138,027,251 (GRCm39) missense probably damaging 0.99
IGL03169:Ptprc APN 1 138,041,357 (GRCm39) missense probably benign 0.15
IGL03308:Ptprc APN 1 138,054,058 (GRCm39) missense possibly damaging 0.70
IGL03404:Ptprc APN 1 138,020,739 (GRCm39) missense probably damaging 1.00
belittle UTSW 1 138,137,493 (GRCm38) intron probably benign
Benighted UTSW 1 138,054,039 (GRCm39) critical splice donor site probably null
bletchley UTSW 1 138,045,600 (GRCm39) missense probably benign
Blush UTSW 1 138,045,458 (GRCm39) intron probably benign
bruise UTSW 1 137,992,509 (GRCm39) missense probably damaging 1.00
chor_muang UTSW 1 138,041,300 (GRCm39) critical splice donor site probably null
crystal UTSW 1 137,999,993 (GRCm39) critical splice donor site probably null
Dumpling UTSW 1 137,995,628 (GRCm39) missense probably damaging 1.00
fluorescent UTSW 1 138,028,930 (GRCm39) missense probably damaging 0.97
fuchsia UTSW 1 138,028,779 (GRCm39) critical splice donor site probably null
Gentian UTSW 1 137,995,623 (GRCm39) critical splice donor site probably null
guotie UTSW 1 137,996,139 (GRCm39) nonsense probably null
guotie2 UTSW 1 138,022,037 (GRCm39) missense probably damaging 0.97
Guotie3 UTSW 1 138,006,189 (GRCm39) missense possibly damaging 0.92
Gyoza UTSW 1 138,011,305 (GRCm39) missense probably damaging 1.00
Half_measure UTSW 1 137,998,987 (GRCm39) missense probably damaging 0.98
jirisan UTSW 1 138,041,416 (GRCm39) nonsense probably null
mauve UTSW 1 138,027,423 (GRCm39) missense probably benign
Perverse UTSW 1 138,028,782 (GRCm39) missense probably benign 0.02
petechiae UTSW 1 138,041,446 (GRCm39) nonsense probably null
ultra UTSW 1 138,006,183 (GRCm39) critical splice donor site probably null
violaceous UTSW 1 138,011,377 (GRCm39) missense possibly damaging 0.77
R0013:Ptprc UTSW 1 138,041,297 (GRCm39) splice site probably null
R0189:Ptprc UTSW 1 138,010,453 (GRCm39) missense probably benign 0.10
R0390:Ptprc UTSW 1 138,050,313 (GRCm39) missense possibly damaging 0.71
R0504:Ptprc UTSW 1 138,016,435 (GRCm39) missense probably damaging 1.00
R0602:Ptprc UTSW 1 138,017,223 (GRCm39) splice site probably benign
R0627:Ptprc UTSW 1 137,996,058 (GRCm39) missense probably damaging 0.99
R0632:Ptprc UTSW 1 138,001,348 (GRCm39) missense probably benign 0.01
R0751:Ptprc UTSW 1 138,020,668 (GRCm39) missense probably damaging 1.00
R0839:Ptprc UTSW 1 138,028,870 (GRCm39) missense possibly damaging 0.47
R0942:Ptprc UTSW 1 137,996,139 (GRCm39) nonsense probably null
R0943:Ptprc UTSW 1 138,038,902 (GRCm39) missense probably damaging 0.96
R1159:Ptprc UTSW 1 138,000,057 (GRCm39) missense probably damaging 1.00
R1442:Ptprc UTSW 1 138,000,050 (GRCm39) missense probably damaging 1.00
R1489:Ptprc UTSW 1 138,047,824 (GRCm39) missense possibly damaging 0.91
R1728:Ptprc UTSW 1 138,035,562 (GRCm39) missense probably benign 0.04
R1728:Ptprc UTSW 1 138,035,561 (GRCm39) missense probably benign 0.22
R1728:Ptprc UTSW 1 138,027,414 (GRCm39) missense probably benign 0.05
R1728:Ptprc UTSW 1 138,039,992 (GRCm39) missense possibly damaging 0.53
R1728:Ptprc UTSW 1 138,035,575 (GRCm39) missense probably benign 0.09
R1729:Ptprc UTSW 1 138,035,561 (GRCm39) missense probably benign 0.22
R1729:Ptprc UTSW 1 138,027,414 (GRCm39) missense probably benign 0.05
R1729:Ptprc UTSW 1 138,039,992 (GRCm39) missense possibly damaging 0.53
R1729:Ptprc UTSW 1 138,035,575 (GRCm39) missense probably benign 0.09
R1729:Ptprc UTSW 1 138,035,562 (GRCm39) missense probably benign 0.04
R1730:Ptprc UTSW 1 138,035,575 (GRCm39) missense probably benign 0.09
R1730:Ptprc UTSW 1 138,039,992 (GRCm39) missense possibly damaging 0.53
R1730:Ptprc UTSW 1 138,027,414 (GRCm39) missense probably benign 0.05
R1730:Ptprc UTSW 1 138,035,561 (GRCm39) missense probably benign 0.22
R1730:Ptprc UTSW 1 138,035,562 (GRCm39) missense probably benign 0.04
R1739:Ptprc UTSW 1 138,035,575 (GRCm39) missense probably benign 0.09
R1739:Ptprc UTSW 1 138,039,992 (GRCm39) missense possibly damaging 0.53
R1739:Ptprc UTSW 1 138,027,414 (GRCm39) missense probably benign 0.05
R1739:Ptprc UTSW 1 138,035,561 (GRCm39) missense probably benign 0.22
R1739:Ptprc UTSW 1 138,035,562 (GRCm39) missense probably benign 0.04
R1762:Ptprc UTSW 1 138,035,575 (GRCm39) missense probably benign 0.09
R1762:Ptprc UTSW 1 138,039,992 (GRCm39) missense possibly damaging 0.53
R1762:Ptprc UTSW 1 138,027,414 (GRCm39) missense probably benign 0.05
R1762:Ptprc UTSW 1 138,035,561 (GRCm39) missense probably benign 0.22
R1762:Ptprc UTSW 1 138,035,562 (GRCm39) missense probably benign 0.04
R1783:Ptprc UTSW 1 138,027,414 (GRCm39) missense probably benign 0.05
R1783:Ptprc UTSW 1 138,035,561 (GRCm39) missense probably benign 0.22
R1783:Ptprc UTSW 1 138,035,562 (GRCm39) missense probably benign 0.04
R1783:Ptprc UTSW 1 138,035,575 (GRCm39) missense probably benign 0.09
R1783:Ptprc UTSW 1 138,039,992 (GRCm39) missense possibly damaging 0.53
R1784:Ptprc UTSW 1 138,035,575 (GRCm39) missense probably benign 0.09
R1784:Ptprc UTSW 1 138,039,992 (GRCm39) missense possibly damaging 0.53
R1784:Ptprc UTSW 1 138,027,414 (GRCm39) missense probably benign 0.05
R1784:Ptprc UTSW 1 138,035,561 (GRCm39) missense probably benign 0.22
R1784:Ptprc UTSW 1 138,035,562 (GRCm39) missense probably benign 0.04
R1785:Ptprc UTSW 1 138,027,414 (GRCm39) missense probably benign 0.05
R1785:Ptprc UTSW 1 138,035,561 (GRCm39) missense probably benign 0.22
R1785:Ptprc UTSW 1 138,039,992 (GRCm39) missense possibly damaging 0.53
R1785:Ptprc UTSW 1 138,035,575 (GRCm39) missense probably benign 0.09
R1785:Ptprc UTSW 1 138,035,562 (GRCm39) missense probably benign 0.04
R1862:Ptprc UTSW 1 138,039,965 (GRCm39) missense probably benign 0.13
R2145:Ptprc UTSW 1 138,001,419 (GRCm39) missense probably damaging 1.00
R2290:Ptprc UTSW 1 138,038,926 (GRCm39) missense probably benign 0.00
R2403:Ptprc UTSW 1 138,016,270 (GRCm39) missense probably damaging 1.00
R2439:Ptprc UTSW 1 137,993,890 (GRCm39) missense possibly damaging 0.67
R2887:Ptprc UTSW 1 138,007,916 (GRCm39) missense probably damaging 1.00
R2906:Ptprc UTSW 1 137,992,272 (GRCm39) missense possibly damaging 0.93
R3774:Ptprc UTSW 1 137,992,511 (GRCm39) missense probably damaging 0.97
R3775:Ptprc UTSW 1 137,992,511 (GRCm39) missense probably damaging 0.97
R3776:Ptprc UTSW 1 137,992,511 (GRCm39) missense probably damaging 0.97
R3834:Ptprc UTSW 1 138,011,305 (GRCm39) missense probably damaging 1.00
R4019:Ptprc UTSW 1 138,006,254 (GRCm39) missense probably damaging 1.00
R4377:Ptprc UTSW 1 137,995,663 (GRCm39) missense probably benign 0.04
R4580:Ptprc UTSW 1 137,998,989 (GRCm39) missense probably benign 0.09
R4923:Ptprc UTSW 1 138,006,236 (GRCm39) missense possibly damaging 0.93
R4925:Ptprc UTSW 1 138,027,235 (GRCm39) missense probably benign 0.04
R4937:Ptprc UTSW 1 138,017,238 (GRCm39) missense probably damaging 1.00
R4970:Ptprc UTSW 1 138,022,037 (GRCm39) missense probably damaging 0.97
R5112:Ptprc UTSW 1 138,022,037 (GRCm39) missense probably damaging 0.97
R5145:Ptprc UTSW 1 138,017,304 (GRCm39) missense probably benign 0.07
R5158:Ptprc UTSW 1 138,102,822 (GRCm39) missense possibly damaging 0.75
R5223:Ptprc UTSW 1 138,045,600 (GRCm39) missense probably benign
R5593:Ptprc UTSW 1 138,045,458 (GRCm39) intron probably benign
R5689:Ptprc UTSW 1 138,045,515 (GRCm39) missense probably benign 0.01
R5885:Ptprc UTSW 1 138,016,246 (GRCm39) missense probably damaging 1.00
R6010:Ptprc UTSW 1 138,028,794 (GRCm39) missense probably benign 0.09
R6026:Ptprc UTSW 1 137,998,987 (GRCm39) missense probably damaging 0.98
R6047:Ptprc UTSW 1 138,028,779 (GRCm39) critical splice donor site probably null
R6173:Ptprc UTSW 1 137,995,628 (GRCm39) missense probably damaging 1.00
R6328:Ptprc UTSW 1 138,041,416 (GRCm39) nonsense probably null
R6383:Ptprc UTSW 1 138,006,189 (GRCm39) missense possibly damaging 0.92
R6436:Ptprc UTSW 1 138,011,377 (GRCm39) missense possibly damaging 0.77
R6492:Ptprc UTSW 1 138,041,300 (GRCm39) critical splice donor site probably null
R6520:Ptprc UTSW 1 138,007,881 (GRCm39) nonsense probably null
R6805:Ptprc UTSW 1 137,995,623 (GRCm39) critical splice donor site probably null
R6830:Ptprc UTSW 1 137,999,993 (GRCm39) critical splice donor site probably null
R6847:Ptprc UTSW 1 138,016,283 (GRCm39) missense probably damaging 0.99
R6960:Ptprc UTSW 1 138,006,183 (GRCm39) critical splice donor site probably null
R6995:Ptprc UTSW 1 138,016,482 (GRCm39) missense probably damaging 1.00
R7009:Ptprc UTSW 1 137,992,291 (GRCm39) missense probably damaging 0.97
R7041:Ptprc UTSW 1 138,054,047 (GRCm39) missense probably benign 0.04
R7055:Ptprc UTSW 1 138,017,309 (GRCm39) missense probably damaging 1.00
R7098:Ptprc UTSW 1 138,027,423 (GRCm39) missense probably benign
R7164:Ptprc UTSW 1 138,045,600 (GRCm39) missense probably benign
R7188:Ptprc UTSW 1 137,998,918 (GRCm39) missense probably damaging 1.00
R7191:Ptprc UTSW 1 138,028,782 (GRCm39) missense probably benign 0.02
R7204:Ptprc UTSW 1 138,045,600 (GRCm39) missense probably benign
R7316:Ptprc UTSW 1 137,992,509 (GRCm39) missense probably damaging 1.00
R7644:Ptprc UTSW 1 137,995,645 (GRCm39) missense probably benign 0.01
R7948:Ptprc UTSW 1 137,992,314 (GRCm39) missense probably benign 0.45
R8029:Ptprc UTSW 1 138,006,197 (GRCm39) missense probably damaging 1.00
R8704:Ptprc UTSW 1 138,043,362 (GRCm39) missense probably benign 0.34
R8824:Ptprc UTSW 1 138,041,446 (GRCm39) nonsense probably null
R8921:Ptprc UTSW 1 138,054,039 (GRCm39) critical splice donor site probably null
R8998:Ptprc UTSW 1 138,028,930 (GRCm39) missense probably damaging 0.97
R8999:Ptprc UTSW 1 138,028,930 (GRCm39) missense probably damaging 0.97
R9154:Ptprc UTSW 1 138,016,302 (GRCm39) missense probably damaging 1.00
R9388:Ptprc UTSW 1 138,011,380 (GRCm39) missense possibly damaging 0.87
R9428:Ptprc UTSW 1 138,041,485 (GRCm39) missense probably benign 0.01
R9467:Ptprc UTSW 1 137,993,960 (GRCm39) missense probably damaging 1.00
R9468:Ptprc UTSW 1 138,044,754 (GRCm39) missense probably benign 0.01
R9479:Ptprc UTSW 1 138,001,388 (GRCm39) missense probably benign 0.38
R9526:Ptprc UTSW 1 137,996,111 (GRCm39) missense probably benign 0.02
R9632:Ptprc UTSW 1 138,008,627 (GRCm39) missense probably damaging 1.00
R9710:Ptprc UTSW 1 138,008,627 (GRCm39) missense probably damaging 1.00
R9714:Ptprc UTSW 1 138,008,687 (GRCm39) missense probably damaging 1.00
R9777:Ptprc UTSW 1 138,047,901 (GRCm39) missense
Z1177:Ptprc UTSW 1 137,995,645 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCTGTGGCCATTCATAAATAC -3'
(R):5'- ATCAGGGCTTCAAGGAACCC -3'

Sequencing Primer
(F):5'- GCTGTGGCCATTCATAAATACTTGTG -3'
(R):5'- TTCAAGGAACCCAGGAAATACATTG -3'
Posted On 2021-03-08