Incidental Mutation 'R8677:Fam171a1'
ID 661423
Institutional Source Beutler Lab
Gene Symbol Fam171a1
Ensembl Gene ENSMUSG00000050530
Gene Name family with sequence similarity 171, member A1
Synonyms 9630050M13Rik
MMRRC Submission 068532-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.126) question?
Stock # R8677 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 3115261-3228843 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 3221352 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 273 (Y273N)
Ref Sequence ENSEMBL: ENSMUSP00000110751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062934] [ENSMUST00000072955] [ENSMUST00000091505] [ENSMUST00000115099]
AlphaFold A2ATK9
Predicted Effect probably damaging
Transcript: ENSMUST00000062934
AA Change: Y268N

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000053619
Gene: ENSMUSG00000050530
AA Change: Y268N

DomainStartEndE-ValueType
Pfam:UPF0560 29 885 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072955
AA Change: Y148N

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072724
Gene: ENSMUSG00000050530
AA Change: Y148N

DomainStartEndE-ValueType
Pfam:UPF0560 1 765 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000091505
AA Change: Y273N

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000089086
Gene: ENSMUSG00000050530
AA Change: Y273N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:UPF0560 34 294 3.1e-146 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115099
AA Change: Y273N

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110751
Gene: ENSMUSG00000050530
AA Change: Y273N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:UPF0560 34 890 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acd A C 8: 106,427,576 (GRCm39) S25R probably damaging Het
Acly A T 11: 100,410,569 (GRCm39) H136Q probably damaging Het
Adrm1 C T 2: 179,813,832 (GRCm39) T2M probably benign Het
Ankrd12 A T 17: 66,331,209 (GRCm39) L246M probably damaging Het
Bltp2 C T 11: 78,174,982 (GRCm39) R1706C probably damaging Het
Cacnb3 T C 15: 98,539,931 (GRCm39) L258P probably damaging Het
Cd36 C T 5: 18,025,493 (GRCm39) V76M probably damaging Het
Cep120 A G 18: 53,871,633 (GRCm39) F80L possibly damaging Het
Clcn1 A T 6: 42,267,519 (GRCm39) probably null Het
Col17a1 T C 19: 47,640,240 (GRCm39) T1042A probably benign Het
Comp A T 8: 70,832,910 (GRCm39) N623Y probably damaging Het
Ctnnal1 A G 4: 56,813,272 (GRCm39) L653P probably benign Het
Cx3cl1 G T 8: 95,506,443 (GRCm39) R149S probably benign Het
Dbndd2 T A 2: 164,330,522 (GRCm39) N58K probably damaging Het
Dclk1 A G 3: 55,409,840 (GRCm39) I595V probably damaging Het
Dhx15 T C 5: 52,341,886 (GRCm39) D144G probably benign Het
Dlat T C 9: 50,570,007 (GRCm39) E120G probably damaging Het
Fndc3b A T 3: 27,511,176 (GRCm39) V778D probably benign Het
Grn T C 11: 102,324,393 (GRCm39) S129P possibly damaging Het
Grxcr1 T C 5: 68,267,757 (GRCm39) F169L possibly damaging Het
Hcn2 A G 10: 79,560,619 (GRCm39) I317V probably benign Het
Heca T C 10: 17,791,424 (GRCm39) N211D probably benign Het
Htr1f T C 16: 64,746,414 (GRCm39) T293A possibly damaging Het
Ifitm10 T A 7: 141,909,749 (GRCm39) I116F probably benign Het
Itprid1 A G 6: 55,849,579 (GRCm39) H37R probably benign Het
Ivl A T 3: 92,479,986 (GRCm39) D26E probably benign Het
Kcnma1 T A 14: 23,436,418 (GRCm39) E761V probably benign Het
Ltbp1 G T 17: 75,655,753 (GRCm39) V923F probably benign Het
Mfsd4b2 A T 10: 39,799,805 (GRCm39) F32L probably benign Het
Micu2 T C 14: 58,161,420 (GRCm39) R301G possibly damaging Het
Miip C T 4: 147,947,503 (GRCm39) C219Y probably damaging Het
Mn1 T A 5: 111,566,885 (GRCm39) L285* probably null Het
Mthfd1l T A 10: 3,998,250 (GRCm39) N664K possibly damaging Het
Mttp A T 3: 137,810,437 (GRCm39) H659Q probably benign Het
Myadml2 G A 11: 120,538,815 (GRCm39) P7S probably benign Het
Nlgn3 T C X: 100,352,390 (GRCm39) V179A probably damaging Het
Nlrp4c C T 7: 6,075,644 (GRCm39) T645I probably damaging Het
Notch1 C T 2: 26,359,936 (GRCm39) V1260I probably damaging Het
Numa1 T C 7: 101,650,148 (GRCm39) L1293P probably damaging Het
Or1a1 A T 11: 74,086,415 (GRCm39) I29F probably benign Het
Or56a4 A G 7: 104,806,775 (GRCm39) L38P probably benign Het
Pcdh12 G T 18: 38,415,191 (GRCm39) H645N probably benign Het
Pdcd1 A T 1: 93,968,952 (GRCm39) L122H probably damaging Het
Pknox2 G A 9: 36,821,887 (GRCm39) P246L probably damaging Het
Polr2a A T 11: 69,626,381 (GRCm39) S1590T possibly damaging Het
Ppp1r16b G A 2: 158,593,098 (GRCm39) D226N probably damaging Het
Proser1 A G 3: 53,385,122 (GRCm39) T335A probably benign Het
Ptprc A G 1: 138,011,335 (GRCm39) I598T probably damaging Het
Rasal3 T C 17: 32,615,828 (GRCm39) T337A probably benign Het
Rasgrp3 A T 17: 75,819,055 (GRCm39) T415S probably benign Het
Rbm7 T A 9: 48,401,273 (GRCm39) R152* probably null Het
Sanbr T C 11: 23,545,471 (GRCm39) D474G probably benign Het
Sf3b2 C T 19: 5,336,257 (GRCm39) R513H probably damaging Het
Slc22a30 A G 19: 8,364,035 (GRCm39) S214P probably benign Het
Spam1 A G 6: 24,796,984 (GRCm39) T312A probably benign Het
Ssh2 A G 11: 77,346,019 (GRCm39) T1335A possibly damaging Het
Tef T A 15: 81,699,169 (GRCm39) L59Q probably damaging Het
Tmem131l A C 3: 83,836,009 (GRCm39) V700G probably damaging Het
Twsg1 A G 17: 66,233,402 (GRCm39) S183P probably damaging Het
Unc13c T C 9: 73,840,243 (GRCm39) T203A probably benign Het
Uqcc6 G T 10: 82,456,050 (GRCm39) T37K possibly damaging Het
Vmn2r75 G T 7: 85,814,410 (GRCm39) P361Q possibly damaging Het
Xirp2 A T 2: 67,346,978 (GRCm39) N3073I probably damaging Het
Zfp114 A G 7: 23,880,070 (GRCm39) N140D probably benign Het
Other mutations in Fam171a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Fam171a1 APN 2 3,179,327 (GRCm39) missense possibly damaging 0.90
IGL01138:Fam171a1 APN 2 3,203,657 (GRCm39) missense possibly damaging 0.80
IGL01317:Fam171a1 APN 2 3,203,663 (GRCm39) missense probably damaging 1.00
IGL02377:Fam171a1 APN 2 3,224,623 (GRCm39) critical splice donor site probably null
IGL02475:Fam171a1 APN 2 3,224,527 (GRCm39) missense possibly damaging 0.53
IGL02477:Fam171a1 APN 2 3,203,612 (GRCm39) missense possibly damaging 0.83
ghosted UTSW 2 3,226,189 (GRCm39) nonsense probably null
R0167:Fam171a1 UTSW 2 3,187,469 (GRCm39) missense probably damaging 1.00
R0426:Fam171a1 UTSW 2 3,226,433 (GRCm39) missense probably benign
R0468:Fam171a1 UTSW 2 3,226,433 (GRCm39) missense probably benign
R0811:Fam171a1 UTSW 2 3,198,464 (GRCm39) missense probably damaging 1.00
R0812:Fam171a1 UTSW 2 3,198,464 (GRCm39) missense probably damaging 1.00
R1099:Fam171a1 UTSW 2 3,226,354 (GRCm39) missense probably benign 0.24
R1694:Fam171a1 UTSW 2 3,226,660 (GRCm39) missense probably benign 0.00
R1817:Fam171a1 UTSW 2 3,179,410 (GRCm39) missense probably benign 0.04
R1869:Fam171a1 UTSW 2 3,227,189 (GRCm39) missense possibly damaging 0.53
R1887:Fam171a1 UTSW 2 3,221,380 (GRCm39) missense probably damaging 1.00
R2173:Fam171a1 UTSW 2 3,226,656 (GRCm39) nonsense probably null
R2355:Fam171a1 UTSW 2 3,226,570 (GRCm39) nonsense probably null
R3690:Fam171a1 UTSW 2 3,227,393 (GRCm39) missense probably benign
R3723:Fam171a1 UTSW 2 3,221,412 (GRCm39) splice site probably benign
R3978:Fam171a1 UTSW 2 3,226,072 (GRCm39) missense probably benign
R4087:Fam171a1 UTSW 2 3,227,333 (GRCm39) missense probably damaging 0.97
R4647:Fam171a1 UTSW 2 3,221,328 (GRCm39) missense probably damaging 0.98
R4744:Fam171a1 UTSW 2 3,225,946 (GRCm39) missense probably damaging 1.00
R4777:Fam171a1 UTSW 2 3,224,550 (GRCm39) missense probably benign 0.03
R4786:Fam171a1 UTSW 2 3,226,615 (GRCm39) missense probably damaging 1.00
R4888:Fam171a1 UTSW 2 3,224,546 (GRCm39) missense probably damaging 0.98
R4982:Fam171a1 UTSW 2 3,179,505 (GRCm39) splice site probably null
R5137:Fam171a1 UTSW 2 3,226,426 (GRCm39) missense probably benign 0.01
R5203:Fam171a1 UTSW 2 3,224,582 (GRCm39) missense probably damaging 0.99
R5233:Fam171a1 UTSW 2 3,179,390 (GRCm39) missense probably damaging 1.00
R5304:Fam171a1 UTSW 2 3,226,654 (GRCm39) missense probably damaging 1.00
R5475:Fam171a1 UTSW 2 3,226,334 (GRCm39) missense possibly damaging 0.91
R5682:Fam171a1 UTSW 2 3,227,126 (GRCm39) missense probably damaging 1.00
R5865:Fam171a1 UTSW 2 3,226,374 (GRCm39) missense probably benign 0.01
R6322:Fam171a1 UTSW 2 3,227,392 (GRCm39) missense probably benign 0.24
R7082:Fam171a1 UTSW 2 3,224,512 (GRCm39) missense probably benign 0.00
R7141:Fam171a1 UTSW 2 3,226,189 (GRCm39) nonsense probably null
R7155:Fam171a1 UTSW 2 3,226,766 (GRCm39) missense probably benign 0.10
R7243:Fam171a1 UTSW 2 3,119,653 (GRCm39) missense probably benign 0.07
R7326:Fam171a1 UTSW 2 3,227,509 (GRCm39) nonsense probably null
R7477:Fam171a1 UTSW 2 3,226,676 (GRCm39) missense probably benign 0.03
R7574:Fam171a1 UTSW 2 3,221,391 (GRCm39) missense probably damaging 1.00
R7745:Fam171a1 UTSW 2 3,226,483 (GRCm39) missense possibly damaging 0.53
R7753:Fam171a1 UTSW 2 3,179,354 (GRCm39) missense probably damaging 0.98
R7871:Fam171a1 UTSW 2 3,226,421 (GRCm39) missense probably benign 0.12
R7958:Fam171a1 UTSW 2 3,179,298 (GRCm39) missense probably damaging 1.00
R8793:Fam171a1 UTSW 2 3,187,535 (GRCm39) missense probably damaging 1.00
R8850:Fam171a1 UTSW 2 3,221,344 (GRCm39) missense probably damaging 1.00
R8865:Fam171a1 UTSW 2 3,226,940 (GRCm39) missense probably damaging 1.00
R9016:Fam171a1 UTSW 2 3,227,434 (GRCm39) missense probably benign 0.43
R9090:Fam171a1 UTSW 2 3,224,543 (GRCm39) missense probably damaging 1.00
R9251:Fam171a1 UTSW 2 3,226,525 (GRCm39) missense probably benign 0.06
R9271:Fam171a1 UTSW 2 3,224,543 (GRCm39) missense probably damaging 1.00
R9350:Fam171a1 UTSW 2 3,226,037 (GRCm39) missense probably benign 0.12
X0019:Fam171a1 UTSW 2 3,226,630 (GRCm39) missense probably benign 0.19
Z1177:Fam171a1 UTSW 2 3,225,971 (GRCm39) missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ATGTGACTGACTGGGCTATCC -3'
(R):5'- CCTCCATGTCAAAGTTCCAGG -3'

Sequencing Primer
(F):5'- CTATCCAGCAAGTTGTGAATGCGAC -3'
(R):5'- AGGTACTGCTCTCCACTGAC -3'
Posted On 2021-03-08