Incidental Mutation 'R8677:Xirp2'
ID 661425
Institutional Source Beutler Lab
Gene Symbol Xirp2
Ensembl Gene ENSMUSG00000027022
Gene Name xin actin-binding repeat containing 2
Synonyms mXin beta, 2310008C07Rik, 2310003D02Rik, Cmya3, myomaxin, A530024P18Rik
MMRRC Submission 068532-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.321) question?
Stock # R8677 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 67276343-67356964 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 67346978 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 3073 (N3073I)
Ref Sequence ENSEMBL: ENSMUSP00000028410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028410] [ENSMUST00000112347]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000028410
AA Change: N3073I

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028410
Gene: ENSMUSG00000027022
AA Change: N3073I

DomainStartEndE-ValueType
low complexity region 176 188 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
Pfam:Xin 343 358 4e-9 PFAM
Pfam:Xin 384 398 7.6e-10 PFAM
Pfam:Xin 420 435 6.4e-9 PFAM
Pfam:Xin 458 473 5.3e-9 PFAM
Pfam:Xin 536 551 4.1e-12 PFAM
Pfam:Xin 574 588 2.1e-8 PFAM
Pfam:Xin 609 623 6e-9 PFAM
Pfam:Xin 642 656 5.6e-8 PFAM
Pfam:Xin 679 693 5.9e-8 PFAM
Pfam:Xin 784 799 1.1e-10 PFAM
Pfam:Xin 822 837 3.9e-11 PFAM
Pfam:Xin 861 875 8.6e-12 PFAM
Pfam:Xin 894 909 2.8e-10 PFAM
Pfam:Xin 1006 1021 3.1e-9 PFAM
Pfam:Xin 1079 1094 6.7e-10 PFAM
Pfam:Xin 1117 1132 1.5e-10 PFAM
Pfam:Xin 1154 1169 2.4e-8 PFAM
Pfam:Xin 1256 1271 4.6e-8 PFAM
Pfam:Xin 1292 1305 1.6e-8 PFAM
low complexity region 1314 1325 N/A INTRINSIC
low complexity region 1547 1559 N/A INTRINSIC
coiled coil region 1683 1704 N/A INTRINSIC
low complexity region 1862 1871 N/A INTRINSIC
low complexity region 2031 2043 N/A INTRINSIC
low complexity region 2052 2063 N/A INTRINSIC
low complexity region 2087 2093 N/A INTRINSIC
low complexity region 2105 2123 N/A INTRINSIC
low complexity region 2159 2177 N/A INTRINSIC
coiled coil region 2288 2311 N/A INTRINSIC
coiled coil region 2738 2767 N/A INTRINSIC
low complexity region 2794 2804 N/A INTRINSIC
low complexity region 2906 2919 N/A INTRINSIC
LIM 3256 3308 4.45e-12 SMART
low complexity region 3356 3367 N/A INTRINSIC
low complexity region 3549 3565 N/A INTRINSIC
low complexity region 3614 3625 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112347
AA Change: N3073I

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107966
Gene: ENSMUSG00000027022
AA Change: N3073I

DomainStartEndE-ValueType
low complexity region 176 188 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
Pfam:Xin 343 358 4.3e-8 PFAM
Pfam:Xin 383 398 6.9e-9 PFAM
Pfam:Xin 420 435 1.8e-8 PFAM
Pfam:Xin 458 473 6.9e-8 PFAM
Pfam:Xin 536 551 2.8e-10 PFAM
Pfam:Xin 608 623 2.4e-8 PFAM
Pfam:Xin 642 657 1.7e-7 PFAM
Pfam:Xin 784 799 3.5e-9 PFAM
Pfam:Xin 822 837 8.9e-10 PFAM
Pfam:Xin 861 876 3.9e-10 PFAM
Pfam:Xin 894 909 5.4e-9 PFAM
Pfam:Xin 1006 1021 6.2e-8 PFAM
Pfam:Xin 1079 1094 2.4e-8 PFAM
Pfam:Xin 1117 1132 9.5e-9 PFAM
Pfam:Xin 1291 1306 5.8e-8 PFAM
low complexity region 1314 1325 N/A INTRINSIC
low complexity region 1547 1559 N/A INTRINSIC
coiled coil region 1683 1704 N/A INTRINSIC
low complexity region 1862 1871 N/A INTRINSIC
low complexity region 2031 2043 N/A INTRINSIC
low complexity region 2052 2063 N/A INTRINSIC
low complexity region 2087 2093 N/A INTRINSIC
low complexity region 2105 2123 N/A INTRINSIC
low complexity region 2159 2177 N/A INTRINSIC
coiled coil region 2288 2311 N/A INTRINSIC
coiled coil region 2738 2767 N/A INTRINSIC
low complexity region 2794 2804 N/A INTRINSIC
low complexity region 2906 2919 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice have an abnormal heart shape, ventricular septal defects, a failure of mature intercalated disc formation, severe growth retardation, and postnatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acd A C 8: 106,427,576 (GRCm39) S25R probably damaging Het
Acly A T 11: 100,410,569 (GRCm39) H136Q probably damaging Het
Adrm1 C T 2: 179,813,832 (GRCm39) T2M probably benign Het
Ankrd12 A T 17: 66,331,209 (GRCm39) L246M probably damaging Het
Bltp2 C T 11: 78,174,982 (GRCm39) R1706C probably damaging Het
Cacnb3 T C 15: 98,539,931 (GRCm39) L258P probably damaging Het
Cd36 C T 5: 18,025,493 (GRCm39) V76M probably damaging Het
Cep120 A G 18: 53,871,633 (GRCm39) F80L possibly damaging Het
Clcn1 A T 6: 42,267,519 (GRCm39) probably null Het
Col17a1 T C 19: 47,640,240 (GRCm39) T1042A probably benign Het
Comp A T 8: 70,832,910 (GRCm39) N623Y probably damaging Het
Ctnnal1 A G 4: 56,813,272 (GRCm39) L653P probably benign Het
Cx3cl1 G T 8: 95,506,443 (GRCm39) R149S probably benign Het
Dbndd2 T A 2: 164,330,522 (GRCm39) N58K probably damaging Het
Dclk1 A G 3: 55,409,840 (GRCm39) I595V probably damaging Het
Dhx15 T C 5: 52,341,886 (GRCm39) D144G probably benign Het
Dlat T C 9: 50,570,007 (GRCm39) E120G probably damaging Het
Fam171a1 T A 2: 3,221,352 (GRCm39) Y273N probably damaging Het
Fndc3b A T 3: 27,511,176 (GRCm39) V778D probably benign Het
Grn T C 11: 102,324,393 (GRCm39) S129P possibly damaging Het
Grxcr1 T C 5: 68,267,757 (GRCm39) F169L possibly damaging Het
Hcn2 A G 10: 79,560,619 (GRCm39) I317V probably benign Het
Heca T C 10: 17,791,424 (GRCm39) N211D probably benign Het
Htr1f T C 16: 64,746,414 (GRCm39) T293A possibly damaging Het
Ifitm10 T A 7: 141,909,749 (GRCm39) I116F probably benign Het
Itprid1 A G 6: 55,849,579 (GRCm39) H37R probably benign Het
Ivl A T 3: 92,479,986 (GRCm39) D26E probably benign Het
Kcnma1 T A 14: 23,436,418 (GRCm39) E761V probably benign Het
Ltbp1 G T 17: 75,655,753 (GRCm39) V923F probably benign Het
Mfsd4b2 A T 10: 39,799,805 (GRCm39) F32L probably benign Het
Micu2 T C 14: 58,161,420 (GRCm39) R301G possibly damaging Het
Miip C T 4: 147,947,503 (GRCm39) C219Y probably damaging Het
Mn1 T A 5: 111,566,885 (GRCm39) L285* probably null Het
Mthfd1l T A 10: 3,998,250 (GRCm39) N664K possibly damaging Het
Mttp A T 3: 137,810,437 (GRCm39) H659Q probably benign Het
Myadml2 G A 11: 120,538,815 (GRCm39) P7S probably benign Het
Nlgn3 T C X: 100,352,390 (GRCm39) V179A probably damaging Het
Nlrp4c C T 7: 6,075,644 (GRCm39) T645I probably damaging Het
Notch1 C T 2: 26,359,936 (GRCm39) V1260I probably damaging Het
Numa1 T C 7: 101,650,148 (GRCm39) L1293P probably damaging Het
Or1a1 A T 11: 74,086,415 (GRCm39) I29F probably benign Het
Or56a4 A G 7: 104,806,775 (GRCm39) L38P probably benign Het
Pcdh12 G T 18: 38,415,191 (GRCm39) H645N probably benign Het
Pdcd1 A T 1: 93,968,952 (GRCm39) L122H probably damaging Het
Pknox2 G A 9: 36,821,887 (GRCm39) P246L probably damaging Het
Polr2a A T 11: 69,626,381 (GRCm39) S1590T possibly damaging Het
Ppp1r16b G A 2: 158,593,098 (GRCm39) D226N probably damaging Het
Proser1 A G 3: 53,385,122 (GRCm39) T335A probably benign Het
Ptprc A G 1: 138,011,335 (GRCm39) I598T probably damaging Het
Rasal3 T C 17: 32,615,828 (GRCm39) T337A probably benign Het
Rasgrp3 A T 17: 75,819,055 (GRCm39) T415S probably benign Het
Rbm7 T A 9: 48,401,273 (GRCm39) R152* probably null Het
Sanbr T C 11: 23,545,471 (GRCm39) D474G probably benign Het
Sf3b2 C T 19: 5,336,257 (GRCm39) R513H probably damaging Het
Slc22a30 A G 19: 8,364,035 (GRCm39) S214P probably benign Het
Spam1 A G 6: 24,796,984 (GRCm39) T312A probably benign Het
Ssh2 A G 11: 77,346,019 (GRCm39) T1335A possibly damaging Het
Tef T A 15: 81,699,169 (GRCm39) L59Q probably damaging Het
Tmem131l A C 3: 83,836,009 (GRCm39) V700G probably damaging Het
Twsg1 A G 17: 66,233,402 (GRCm39) S183P probably damaging Het
Unc13c T C 9: 73,840,243 (GRCm39) T203A probably benign Het
Uqcc6 G T 10: 82,456,050 (GRCm39) T37K possibly damaging Het
Vmn2r75 G T 7: 85,814,410 (GRCm39) P361Q possibly damaging Het
Zfp114 A G 7: 23,880,070 (GRCm39) N140D probably benign Het
Other mutations in Xirp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Xirp2 APN 2 67,343,719 (GRCm39) missense probably benign 0.37
IGL00336:Xirp2 APN 2 67,342,942 (GRCm39) missense possibly damaging 0.93
IGL00596:Xirp2 APN 2 67,345,226 (GRCm39) missense probably benign 0.08
IGL00862:Xirp2 APN 2 67,347,247 (GRCm39) missense probably benign 0.00
IGL01124:Xirp2 APN 2 67,338,959 (GRCm39) missense probably damaging 0.99
IGL01289:Xirp2 APN 2 67,343,525 (GRCm39) missense probably damaging 0.99
IGL01293:Xirp2 APN 2 67,345,528 (GRCm39) missense possibly damaging 0.51
IGL01372:Xirp2 APN 2 67,344,334 (GRCm39) missense possibly damaging 0.93
IGL01385:Xirp2 APN 2 67,340,021 (GRCm39) missense probably damaging 0.99
IGL01411:Xirp2 APN 2 67,344,427 (GRCm39) missense probably benign 0.00
IGL01413:Xirp2 APN 2 67,340,270 (GRCm39) missense probably damaging 1.00
IGL01551:Xirp2 APN 2 67,343,849 (GRCm39) missense probably benign
IGL01672:Xirp2 APN 2 67,338,846 (GRCm39) missense probably benign
IGL01724:Xirp2 APN 2 67,356,411 (GRCm39) missense probably benign
IGL01739:Xirp2 APN 2 67,345,482 (GRCm39) missense probably benign 0.15
IGL01807:Xirp2 APN 2 67,345,375 (GRCm39) missense probably benign
IGL02006:Xirp2 APN 2 67,342,306 (GRCm39) missense possibly damaging 0.85
IGL02030:Xirp2 APN 2 67,339,325 (GRCm39) missense probably benign 0.06
IGL02066:Xirp2 APN 2 67,356,415 (GRCm39) missense probably benign
IGL02138:Xirp2 APN 2 67,347,300 (GRCm39) missense probably benign 0.15
IGL02250:Xirp2 APN 2 67,344,356 (GRCm39) missense probably benign 0.03
IGL02265:Xirp2 APN 2 67,347,494 (GRCm39) missense possibly damaging 0.94
IGL02274:Xirp2 APN 2 67,338,995 (GRCm39) missense probably benign 0.12
IGL02322:Xirp2 APN 2 67,339,082 (GRCm39) missense probably benign 0.00
IGL02327:Xirp2 APN 2 67,340,444 (GRCm39) missense probably damaging 1.00
IGL02378:Xirp2 APN 2 67,344,112 (GRCm39) missense probably benign 0.00
IGL02492:Xirp2 APN 2 67,346,511 (GRCm39) missense probably damaging 0.99
IGL02549:Xirp2 APN 2 67,343,446 (GRCm39) missense probably benign 0.03
IGL02578:Xirp2 APN 2 67,341,591 (GRCm39) missense probably damaging 0.96
IGL02635:Xirp2 APN 2 67,338,254 (GRCm39) missense possibly damaging 0.86
IGL02654:Xirp2 APN 2 67,345,015 (GRCm39) missense possibly damaging 0.86
IGL02663:Xirp2 APN 2 67,339,802 (GRCm39) missense possibly damaging 0.92
IGL02795:Xirp2 APN 2 67,339,480 (GRCm39) missense probably damaging 1.00
IGL02934:Xirp2 APN 2 67,346,020 (GRCm39) missense probably benign 0.33
IGL03003:Xirp2 APN 2 67,345,906 (GRCm39) missense possibly damaging 0.93
IGL03069:Xirp2 APN 2 67,339,876 (GRCm39) missense possibly damaging 0.91
IGL03286:Xirp2 APN 2 67,346,654 (GRCm39) missense probably damaging 0.99
IGL03326:Xirp2 APN 2 67,312,590 (GRCm39) missense probably benign 0.01
IGL03381:Xirp2 APN 2 67,344,570 (GRCm39) missense probably benign 0.34
IGL03394:Xirp2 APN 2 67,345,538 (GRCm39) missense probably damaging 0.99
Ordovician UTSW 2 67,312,707 (GRCm39) missense possibly damaging 0.72
silurian UTSW 2 67,349,609 (GRCm39) missense probably damaging 0.99
3-1:Xirp2 UTSW 2 67,338,542 (GRCm39) missense possibly damaging 0.95
H8562:Xirp2 UTSW 2 67,345,801 (GRCm39) missense probably benign
PIT4142001:Xirp2 UTSW 2 67,349,706 (GRCm39) splice site probably benign
PIT4260001:Xirp2 UTSW 2 67,341,941 (GRCm39) missense possibly damaging 0.96
PIT4445001:Xirp2 UTSW 2 67,340,116 (GRCm39) missense possibly damaging 0.84
PIT4531001:Xirp2 UTSW 2 67,345,826 (GRCm39) missense possibly damaging 0.73
R0015:Xirp2 UTSW 2 67,341,243 (GRCm39) nonsense probably null
R0063:Xirp2 UTSW 2 67,339,427 (GRCm39) missense probably damaging 0.99
R0063:Xirp2 UTSW 2 67,339,427 (GRCm39) missense probably damaging 0.99
R0066:Xirp2 UTSW 2 67,342,484 (GRCm39) missense possibly damaging 0.85
R0109:Xirp2 UTSW 2 67,349,622 (GRCm39) missense probably damaging 1.00
R0111:Xirp2 UTSW 2 67,338,722 (GRCm39) missense probably damaging 0.99
R0115:Xirp2 UTSW 2 67,340,253 (GRCm39) missense possibly damaging 0.92
R0117:Xirp2 UTSW 2 67,347,464 (GRCm39) missense possibly damaging 0.94
R0133:Xirp2 UTSW 2 67,347,468 (GRCm39) missense probably benign
R0282:Xirp2 UTSW 2 67,343,724 (GRCm39) missense probably damaging 0.96
R0463:Xirp2 UTSW 2 67,345,262 (GRCm39) missense probably benign 0.02
R0481:Xirp2 UTSW 2 67,340,253 (GRCm39) missense possibly damaging 0.92
R0488:Xirp2 UTSW 2 67,345,165 (GRCm39) missense possibly damaging 0.90
R0548:Xirp2 UTSW 2 67,344,758 (GRCm39) missense probably benign 0.00
R0557:Xirp2 UTSW 2 67,346,695 (GRCm39) missense probably benign 0.33
R0582:Xirp2 UTSW 2 67,339,210 (GRCm39) missense probably benign
R0723:Xirp2 UTSW 2 67,342,559 (GRCm39) missense probably damaging 0.98
R0835:Xirp2 UTSW 2 67,338,254 (GRCm39) missense possibly damaging 0.86
R1160:Xirp2 UTSW 2 67,340,231 (GRCm39) missense possibly damaging 0.92
R1189:Xirp2 UTSW 2 67,343,805 (GRCm39) missense probably damaging 0.96
R1474:Xirp2 UTSW 2 67,355,411 (GRCm39) missense probably benign 0.00
R1513:Xirp2 UTSW 2 67,341,874 (GRCm39) missense probably benign 0.00
R1514:Xirp2 UTSW 2 67,344,667 (GRCm39) nonsense probably null
R1519:Xirp2 UTSW 2 67,346,023 (GRCm39) missense probably benign 0.44
R1532:Xirp2 UTSW 2 67,344,283 (GRCm39) missense probably benign 0.00
R1537:Xirp2 UTSW 2 67,340,357 (GRCm39) missense probably damaging 0.98
R1541:Xirp2 UTSW 2 67,342,634 (GRCm39) missense possibly damaging 0.70
R1543:Xirp2 UTSW 2 67,338,383 (GRCm39) missense probably benign
R1607:Xirp2 UTSW 2 67,340,639 (GRCm39) nonsense probably null
R1620:Xirp2 UTSW 2 67,341,179 (GRCm39) missense probably damaging 0.98
R1709:Xirp2 UTSW 2 67,340,215 (GRCm39) missense probably benign 0.33
R1713:Xirp2 UTSW 2 67,342,762 (GRCm39) missense probably benign 0.25
R1828:Xirp2 UTSW 2 67,345,582 (GRCm39) missense possibly damaging 0.86
R1834:Xirp2 UTSW 2 67,341,484 (GRCm39) missense probably damaging 0.99
R1905:Xirp2 UTSW 2 67,346,700 (GRCm39) missense probably damaging 0.98
R1907:Xirp2 UTSW 2 67,346,700 (GRCm39) missense probably damaging 0.98
R1943:Xirp2 UTSW 2 67,342,959 (GRCm39) missense probably benign 0.34
R1971:Xirp2 UTSW 2 67,342,039 (GRCm39) missense possibly damaging 0.48
R1998:Xirp2 UTSW 2 67,339,393 (GRCm39) missense probably damaging 0.97
R2075:Xirp2 UTSW 2 67,340,545 (GRCm39) missense probably benign 0.33
R2132:Xirp2 UTSW 2 67,338,392 (GRCm39) missense possibly damaging 0.72
R2175:Xirp2 UTSW 2 67,340,258 (GRCm39) missense probably damaging 0.99
R2310:Xirp2 UTSW 2 67,356,591 (GRCm39) missense probably benign 0.19
R2338:Xirp2 UTSW 2 67,341,114 (GRCm39) missense probably damaging 0.98
R2426:Xirp2 UTSW 2 67,344,815 (GRCm39) missense probably benign 0.02
R2483:Xirp2 UTSW 2 67,355,336 (GRCm39) missense probably benign
R3084:Xirp2 UTSW 2 67,339,393 (GRCm39) missense probably damaging 0.97
R3113:Xirp2 UTSW 2 67,340,491 (GRCm39) missense probably benign 0.33
R3903:Xirp2 UTSW 2 67,338,380 (GRCm39) missense probably benign 0.40
R3916:Xirp2 UTSW 2 67,341,766 (GRCm39) missense probably benign 0.25
R3928:Xirp2 UTSW 2 67,342,013 (GRCm39) missense possibly damaging 0.85
R4025:Xirp2 UTSW 2 67,341,746 (GRCm39) missense probably benign 0.12
R4135:Xirp2 UTSW 2 67,355,741 (GRCm39) missense probably benign 0.00
R4223:Xirp2 UTSW 2 67,346,837 (GRCm39) missense possibly damaging 0.66
R4257:Xirp2 UTSW 2 67,346,383 (GRCm39) missense probably benign 0.31
R4499:Xirp2 UTSW 2 67,343,782 (GRCm39) missense probably benign 0.08
R4577:Xirp2 UTSW 2 67,344,241 (GRCm39) missense probably damaging 0.99
R4739:Xirp2 UTSW 2 67,349,609 (GRCm39) missense probably damaging 0.99
R4758:Xirp2 UTSW 2 67,346,879 (GRCm39) missense probably damaging 0.98
R4834:Xirp2 UTSW 2 67,346,750 (GRCm39) missense probably benign 0.26
R4855:Xirp2 UTSW 2 67,341,408 (GRCm39) missense possibly damaging 0.96
R4923:Xirp2 UTSW 2 67,343,237 (GRCm39) missense probably benign
R4936:Xirp2 UTSW 2 67,340,163 (GRCm39) missense possibly damaging 0.85
R5032:Xirp2 UTSW 2 67,356,014 (GRCm39) missense possibly damaging 0.84
R5049:Xirp2 UTSW 2 67,347,478 (GRCm39) missense probably benign 0.03
R5077:Xirp2 UTSW 2 67,344,821 (GRCm39) missense probably benign
R5090:Xirp2 UTSW 2 67,355,814 (GRCm39) missense possibly damaging 0.83
R5107:Xirp2 UTSW 2 67,342,205 (GRCm39) missense probably damaging 1.00
R5107:Xirp2 UTSW 2 67,340,054 (GRCm39) missense probably damaging 0.99
R5187:Xirp2 UTSW 2 67,345,711 (GRCm39) missense probably benign 0.01
R5241:Xirp2 UTSW 2 67,312,704 (GRCm39) nonsense probably null
R5307:Xirp2 UTSW 2 67,341,506 (GRCm39) missense probably damaging 0.99
R5342:Xirp2 UTSW 2 67,343,805 (GRCm39) missense probably damaging 0.96
R5370:Xirp2 UTSW 2 67,342,496 (GRCm39) missense possibly damaging 0.72
R5375:Xirp2 UTSW 2 67,342,250 (GRCm39) missense probably damaging 0.99
R5407:Xirp2 UTSW 2 67,341,313 (GRCm39) missense probably benign 0.33
R5514:Xirp2 UTSW 2 67,335,465 (GRCm39) missense probably benign 0.03
R5531:Xirp2 UTSW 2 67,345,646 (GRCm39) missense probably benign 0.42
R5590:Xirp2 UTSW 2 67,344,379 (GRCm39) missense probably benign 0.23
R5646:Xirp2 UTSW 2 67,341,134 (GRCm39) missense probably damaging 0.99
R5649:Xirp2 UTSW 2 67,347,239 (GRCm39) missense probably benign 0.00
R5686:Xirp2 UTSW 2 67,312,642 (GRCm39) missense probably damaging 0.99
R5761:Xirp2 UTSW 2 67,341,311 (GRCm39) missense probably benign 0.00
R5777:Xirp2 UTSW 2 67,340,348 (GRCm39) missense possibly damaging 0.92
R5785:Xirp2 UTSW 2 67,340,006 (GRCm39) missense probably damaging 0.96
R5843:Xirp2 UTSW 2 67,307,129 (GRCm39) start gained probably benign
R5846:Xirp2 UTSW 2 67,339,587 (GRCm39) missense probably damaging 0.98
R5875:Xirp2 UTSW 2 67,335,424 (GRCm39) missense probably benign 0.00
R5896:Xirp2 UTSW 2 67,340,290 (GRCm39) missense possibly damaging 0.91
R5896:Xirp2 UTSW 2 67,339,042 (GRCm39) missense probably benign 0.32
R5901:Xirp2 UTSW 2 67,343,410 (GRCm39) missense possibly damaging 0.91
R5934:Xirp2 UTSW 2 67,355,148 (GRCm39) missense possibly damaging 0.92
R5950:Xirp2 UTSW 2 67,341,664 (GRCm39) missense possibly damaging 0.95
R5996:Xirp2 UTSW 2 67,341,994 (GRCm39) missense possibly damaging 0.91
R6013:Xirp2 UTSW 2 67,341,287 (GRCm39) missense possibly damaging 0.48
R6048:Xirp2 UTSW 2 67,338,587 (GRCm39) missense possibly damaging 0.96
R6111:Xirp2 UTSW 2 67,342,161 (GRCm39) missense possibly damaging 0.86
R6180:Xirp2 UTSW 2 67,335,921 (GRCm39) critical splice donor site probably null
R6342:Xirp2 UTSW 2 67,341,994 (GRCm39) missense possibly damaging 0.91
R6346:Xirp2 UTSW 2 67,346,425 (GRCm39) missense probably benign 0.00
R6603:Xirp2 UTSW 2 67,346,888 (GRCm39) missense probably benign
R6604:Xirp2 UTSW 2 67,340,189 (GRCm39) missense possibly damaging 0.86
R6669:Xirp2 UTSW 2 67,343,699 (GRCm39) missense possibly damaging 0.78
R6701:Xirp2 UTSW 2 67,346,569 (GRCm39) missense possibly damaging 0.94
R6726:Xirp2 UTSW 2 67,343,212 (GRCm39) missense possibly damaging 0.88
R6833:Xirp2 UTSW 2 67,340,294 (GRCm39) missense probably benign 0.12
R6897:Xirp2 UTSW 2 67,338,911 (GRCm39) missense probably damaging 1.00
R6933:Xirp2 UTSW 2 67,345,201 (GRCm39) missense probably benign 0.34
R7020:Xirp2 UTSW 2 67,355,913 (GRCm39) missense probably benign
R7042:Xirp2 UTSW 2 67,343,633 (GRCm39) missense probably benign 0.12
R7060:Xirp2 UTSW 2 67,345,952 (GRCm39) missense probably damaging 1.00
R7179:Xirp2 UTSW 2 67,340,177 (GRCm39) missense probably benign 0.00
R7229:Xirp2 UTSW 2 67,355,895 (GRCm39) missense probably damaging 0.99
R7253:Xirp2 UTSW 2 67,343,826 (GRCm39) missense probably benign
R7284:Xirp2 UTSW 2 67,347,173 (GRCm39) missense probably benign
R7450:Xirp2 UTSW 2 67,340,159 (GRCm39) missense possibly damaging 0.86
R7476:Xirp2 UTSW 2 67,340,978 (GRCm39) missense probably benign 0.01
R7489:Xirp2 UTSW 2 67,355,904 (GRCm39) missense possibly damaging 0.83
R7513:Xirp2 UTSW 2 67,341,108 (GRCm39) missense possibly damaging 0.86
R7549:Xirp2 UTSW 2 67,339,241 (GRCm39) missense possibly damaging 0.91
R7563:Xirp2 UTSW 2 67,340,245 (GRCm39) missense probably damaging 0.99
R7567:Xirp2 UTSW 2 67,346,326 (GRCm39) missense probably benign 0.02
R7577:Xirp2 UTSW 2 67,345,309 (GRCm39) missense possibly damaging 0.65
R7597:Xirp2 UTSW 2 67,356,099 (GRCm39) missense possibly damaging 0.84
R7610:Xirp2 UTSW 2 67,356,306 (GRCm39) missense possibly damaging 0.92
R7613:Xirp2 UTSW 2 67,344,842 (GRCm39) missense probably benign 0.00
R7669:Xirp2 UTSW 2 67,342,521 (GRCm39) missense probably benign 0.00
R7670:Xirp2 UTSW 2 67,340,917 (GRCm39) missense possibly damaging 0.91
R7673:Xirp2 UTSW 2 67,347,431 (GRCm39) missense probably damaging 1.00
R7682:Xirp2 UTSW 2 67,339,193 (GRCm39) missense probably damaging 0.99
R7755:Xirp2 UTSW 2 67,345,526 (GRCm39) missense probably benign
R7805:Xirp2 UTSW 2 67,340,325 (GRCm39) missense probably benign 0.23
R7815:Xirp2 UTSW 2 67,339,756 (GRCm39) missense probably damaging 1.00
R7823:Xirp2 UTSW 2 67,342,118 (GRCm39) missense probably damaging 1.00
R7842:Xirp2 UTSW 2 67,355,289 (GRCm39) missense probably benign 0.00
R7863:Xirp2 UTSW 2 67,343,074 (GRCm39) missense probably benign 0.03
R7895:Xirp2 UTSW 2 67,339,841 (GRCm39) missense probably damaging 0.96
R7948:Xirp2 UTSW 2 67,349,658 (GRCm39) missense possibly damaging 0.95
R8083:Xirp2 UTSW 2 67,339,043 (GRCm39) missense possibly damaging 0.71
R8125:Xirp2 UTSW 2 67,342,379 (GRCm39) missense probably benign 0.25
R8154:Xirp2 UTSW 2 67,342,017 (GRCm39) missense possibly damaging 0.48
R8169:Xirp2 UTSW 2 67,343,543 (GRCm39) missense probably benign 0.00
R8213:Xirp2 UTSW 2 67,307,210 (GRCm39) missense probably damaging 0.96
R8215:Xirp2 UTSW 2 67,346,853 (GRCm39) missense probably benign 0.08
R8230:Xirp2 UTSW 2 67,346,009 (GRCm39) missense probably damaging 0.99
R8266:Xirp2 UTSW 2 67,338,918 (GRCm39) missense probably damaging 0.98
R8350:Xirp2 UTSW 2 67,355,713 (GRCm39) missense probably benign
R8432:Xirp2 UTSW 2 67,340,962 (GRCm39) missense probably benign
R8441:Xirp2 UTSW 2 67,343,159 (GRCm39) missense possibly damaging 0.85
R8773:Xirp2 UTSW 2 67,355,527 (GRCm39) missense probably benign
R8794:Xirp2 UTSW 2 67,341,557 (GRCm39) missense probably damaging 0.98
R8930:Xirp2 UTSW 2 67,312,707 (GRCm39) missense possibly damaging 0.72
R8932:Xirp2 UTSW 2 67,312,707 (GRCm39) missense possibly damaging 0.72
R8939:Xirp2 UTSW 2 67,346,488 (GRCm39) missense probably benign 0.04
R9263:Xirp2 UTSW 2 67,345,289 (GRCm39) missense possibly damaging 0.76
R9313:Xirp2 UTSW 2 67,347,322 (GRCm39) missense probably damaging 0.99
R9350:Xirp2 UTSW 2 67,349,653 (GRCm39) missense probably damaging 1.00
R9375:Xirp2 UTSW 2 67,342,118 (GRCm39) missense probably damaging 1.00
R9442:Xirp2 UTSW 2 67,342,235 (GRCm39) nonsense probably null
R9447:Xirp2 UTSW 2 67,338,950 (GRCm39) missense probably damaging 0.98
R9457:Xirp2 UTSW 2 67,345,976 (GRCm39) missense probably benign 0.03
R9507:Xirp2 UTSW 2 67,344,280 (GRCm39) missense possibly damaging 0.95
R9529:Xirp2 UTSW 2 67,355,540 (GRCm39) missense possibly damaging 0.93
R9569:Xirp2 UTSW 2 67,341,242 (GRCm39) missense probably damaging 1.00
R9607:Xirp2 UTSW 2 67,341,106 (GRCm39) missense possibly damaging 0.72
R9648:Xirp2 UTSW 2 67,346,599 (GRCm39) missense probably benign
R9651:Xirp2 UTSW 2 67,344,167 (GRCm39) missense possibly damaging 0.72
R9678:Xirp2 UTSW 2 67,339,788 (GRCm39) missense possibly damaging 0.91
R9691:Xirp2 UTSW 2 67,340,539 (GRCm39) missense possibly damaging 0.91
R9777:Xirp2 UTSW 2 67,347,379 (GRCm39) missense possibly damaging 0.85
RF035:Xirp2 UTSW 2 67,355,888 (GRCm39) utr 3 prime probably benign
RF040:Xirp2 UTSW 2 67,355,888 (GRCm39) utr 3 prime probably benign
X0063:Xirp2 UTSW 2 67,346,467 (GRCm39) missense probably benign 0.04
X0065:Xirp2 UTSW 2 67,345,462 (GRCm39) missense probably benign 0.34
Z1088:Xirp2 UTSW 2 67,343,665 (GRCm39) missense probably benign 0.03
Z1176:Xirp2 UTSW 2 67,344,923 (GRCm39) missense probably benign 0.17
Z1176:Xirp2 UTSW 2 67,341,737 (GRCm39) missense probably damaging 0.99
Z1176:Xirp2 UTSW 2 67,355,576 (GRCm39) missense probably damaging 1.00
Z1177:Xirp2 UTSW 2 67,355,715 (GRCm39) missense probably benign
Z1177:Xirp2 UTSW 2 67,340,537 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGTAGACGCTCAAGAGGCAG -3'
(R):5'- TTTCGGATGTCTGTAAGAAAAGCC -3'

Sequencing Primer
(F):5'- AACGGAGACTTATGTTCATAAAGAC -3'
(R):5'- GCCTGTAAAATTAGCAGTTTCAGAAG -3'
Posted On 2021-03-08