Incidental Mutation 'R8677:Mttp'
ID 661434
Institutional Source Beutler Lab
Gene Symbol Mttp
Ensembl Gene ENSMUSG00000028158
Gene Name microsomal triglyceride transfer protein
Synonyms 1810043K16Rik, MTP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.812) question?
Stock # R8677 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 138089854-138144968 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 138104676 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 659 (H659Q)
Ref Sequence ENSEMBL: ENSMUSP00000029805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029805] [ENSMUST00000098580]
AlphaFold O08601
Predicted Effect probably benign
Transcript: ENSMUST00000029805
AA Change: H659Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000029805
Gene: ENSMUSG00000028158
AA Change: H659Q

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LPD_N 28 579 8.87e-165 SMART
Blast:LPD_N 582 695 4e-58 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000098580
AA Change: H674Q

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000096179
Gene: ENSMUSG00000028158
AA Change: H674Q

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LPD_N 43 594 8.87e-165 SMART
Blast:LPD_N 597 710 6e-58 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MTP encodes the large subunit of the heterodimeric microsomal triglyceride transfer protein. Protein disulfide isomerase (PDI) completes the heterodimeric microsomal triglyceride transfer protein, which has been shown to play a central role in lipoprotein assembly. Mutations in MTP can cause abetalipoproteinemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most embryos homozygous for a reporter allele die at midgestation displaying delayed growth, neurodevelopmental anomalies, impaired erythropoiesis, deficient yolk sac lipoprotein production, hemorrhage and necrosis. Heterozygous mutant mice display altered plasma lipid and lipoprotein profiles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,595,471 D474G probably benign Het
1190007I07Rik G T 10: 82,620,216 T37K possibly damaging Het
2610507B11Rik C T 11: 78,284,156 R1706C probably damaging Het
Acd A C 8: 105,700,944 S25R probably damaging Het
Acly A T 11: 100,519,743 H136Q probably damaging Het
Adrm1 C T 2: 180,172,039 T2M probably benign Het
Ankrd12 A T 17: 66,024,214 L246M probably damaging Het
Cacnb3 T C 15: 98,642,050 L258P probably damaging Het
Ccdc129 A G 6: 55,872,594 H37R probably benign Het
Cd36 C T 5: 17,820,495 V76M probably damaging Het
Cep120 A G 18: 53,738,561 F80L possibly damaging Het
Clcn1 A T 6: 42,290,585 probably null Het
Col17a1 T C 19: 47,651,801 T1042A probably benign Het
Comp A T 8: 70,380,260 N623Y probably damaging Het
Ctnnal1 A G 4: 56,813,272 L653P probably benign Het
Cx3cl1 G T 8: 94,779,815 R149S probably benign Het
Dbndd2 T A 2: 164,488,602 N58K probably damaging Het
Dclk1 A G 3: 55,502,419 I595V probably damaging Het
Dhx15 T C 5: 52,184,544 D144G probably benign Het
Dlat T C 9: 50,658,707 E120G probably damaging Het
Fam171a1 T A 2: 3,220,315 Y273N probably damaging Het
Fndc3b A T 3: 27,457,027 V778D probably benign Het
Grn T C 11: 102,433,567 S129P possibly damaging Het
Grxcr1 T C 5: 68,110,414 F169L possibly damaging Het
Hcn2 A G 10: 79,724,785 I317V probably benign Het
Heca T C 10: 17,915,676 N211D probably benign Het
Htr1f T C 16: 64,926,051 T293A possibly damaging Het
Ifitm10 T A 7: 142,356,012 I116F probably benign Het
Ivl A T 3: 92,572,679 D26E probably benign Het
Kcnma1 T A 14: 23,386,350 E761V probably benign Het
Ltbp1 G T 17: 75,348,758 V923F probably benign Het
Mfsd4b2 A T 10: 39,923,809 F32L probably benign Het
Micu2 T C 14: 57,923,963 R301G possibly damaging Het
Miip C T 4: 147,863,046 C219Y probably damaging Het
Mn1 T A 5: 111,419,019 L285* probably null Het
Mthfd1l T A 10: 4,048,250 N664K possibly damaging Het
Myadml2 G A 11: 120,647,989 P7S probably benign Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Nlrp4c C T 7: 6,072,645 T645I probably damaging Het
Notch1 C T 2: 26,469,924 V1260I probably damaging Het
Numa1 T C 7: 102,000,941 L1293P probably damaging Het
Olfr403 A T 11: 74,195,589 I29F probably benign Het
Olfr684 A G 7: 105,157,568 L38P probably benign Het
Pcdh12 G T 18: 38,282,138 H645N probably benign Het
Pdcd1 A T 1: 94,041,227 L122H probably damaging Het
Pknox2 G A 9: 36,910,591 P246L probably damaging Het
Polr2a A T 11: 69,735,555 S1590T possibly damaging Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
Proser1 A G 3: 53,477,701 T335A probably benign Het
Ptprc A G 1: 138,083,597 I598T probably damaging Het
Rasal3 T C 17: 32,396,854 T337A probably benign Het
Rasgrp3 A T 17: 75,512,060 T415S probably benign Het
Rbm7 T A 9: 48,489,973 R152* probably null Het
Sf3b2 C T 19: 5,286,229 R513H probably damaging Het
Slc22a30 A G 19: 8,386,671 S214P probably benign Het
Spam1 A G 6: 24,796,985 T312A probably benign Het
Ssh2 A G 11: 77,455,193 T1335A possibly damaging Het
Tef T A 15: 81,814,968 L59Q probably damaging Het
Tmem131l A C 3: 83,928,702 V700G probably damaging Het
Twsg1 A G 17: 65,926,407 S183P probably damaging Het
Unc13c T C 9: 73,932,961 T203A probably benign Het
Vmn2r75 G T 7: 86,165,202 P361Q possibly damaging Het
Xirp2 A T 2: 67,516,634 N3073I probably damaging Het
Zfp114 A G 7: 24,180,645 N140D probably benign Het
Other mutations in Mttp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Mttp APN 3 138109015 missense possibly damaging 0.84
IGL00983:Mttp APN 3 138115129 splice site probably benign
IGL01128:Mttp APN 3 138133997 splice site probably null
IGL01607:Mttp APN 3 138104698 missense probably damaging 0.99
IGL01760:Mttp APN 3 138111736 missense probably benign 0.00
IGL01947:Mttp APN 3 138107129 missense probably damaging 1.00
IGL02184:Mttp APN 3 138116000 critical splice donor site probably null
IGL02932:Mttp APN 3 138111744 missense probably benign 0.07
IGL02957:Mttp APN 3 138109081 missense possibly damaging 0.95
IGL03082:Mttp APN 3 138123795 missense probably benign 0.01
IGL03302:Mttp APN 3 138104707 missense possibly damaging 0.90
IGL03381:Mttp APN 3 138104943 missense probably damaging 1.00
G1patch:Mttp UTSW 3 138107238 missense probably damaging 1.00
P0040:Mttp UTSW 3 138112566 missense possibly damaging 0.82
R0543:Mttp UTSW 3 138111696 missense possibly damaging 0.75
R0738:Mttp UTSW 3 138103313 missense probably damaging 1.00
R0967:Mttp UTSW 3 138092723 missense probably benign 0.00
R1281:Mttp UTSW 3 138107219 missense possibly damaging 0.95
R1565:Mttp UTSW 3 138116405 critical splice donor site probably null
R1660:Mttp UTSW 3 138103193 missense probably damaging 1.00
R1828:Mttp UTSW 3 138107280 missense probably damaging 1.00
R1886:Mttp UTSW 3 138092615 missense probably damaging 1.00
R1912:Mttp UTSW 3 138116027 missense probably benign 0.01
R1938:Mttp UTSW 3 138125121 missense probably benign 0.21
R2020:Mttp UTSW 3 138118402 missense probably damaging 0.98
R2109:Mttp UTSW 3 138095002 missense probably benign 0.27
R2336:Mttp UTSW 3 138116095 missense possibly damaging 0.81
R2392:Mttp UTSW 3 138095021 missense probably damaging 0.98
R3021:Mttp UTSW 3 138111703 missense probably benign
R3774:Mttp UTSW 3 138114263 splice site probably null
R3776:Mttp UTSW 3 138114263 splice site probably null
R4687:Mttp UTSW 3 138092735 missense possibly damaging 0.66
R4708:Mttp UTSW 3 138134098 unclassified probably benign
R4756:Mttp UTSW 3 138116071 missense possibly damaging 0.77
R4832:Mttp UTSW 3 138116050 missense probably benign
R5377:Mttp UTSW 3 138105029 missense probably benign 0.03
R5670:Mttp UTSW 3 138125113 missense probably damaging 0.99
R6613:Mttp UTSW 3 138109078 missense probably damaging 1.00
R6725:Mttp UTSW 3 138107238 missense probably damaging 1.00
R6799:Mttp UTSW 3 138095080 missense probably benign 0.04
R6920:Mttp UTSW 3 138115282 missense possibly damaging 0.49
R7074:Mttp UTSW 3 138107273 missense possibly damaging 0.53
R7131:Mttp UTSW 3 138116132 missense probably benign 0.13
R7275:Mttp UTSW 3 138123785 missense probably benign 0.19
R7291:Mttp UTSW 3 138091203 missense probably damaging 1.00
R7310:Mttp UTSW 3 138095022 missense probably damaging 1.00
R7769:Mttp UTSW 3 138103112 missense probably damaging 1.00
R7909:Mttp UTSW 3 138118417 nonsense probably null
R8037:Mttp UTSW 3 138091122 missense probably damaging 1.00
R8220:Mttp UTSW 3 138123848 missense probably benign 0.00
R8335:Mttp UTSW 3 138103212 missense possibly damaging 0.90
R8352:Mttp UTSW 3 138112613 missense probably damaging 1.00
R8452:Mttp UTSW 3 138112613 missense probably damaging 1.00
R8536:Mttp UTSW 3 138104943 missense probably damaging 1.00
R8877:Mttp UTSW 3 138112556 missense probably damaging 0.99
R9233:Mttp UTSW 3 138116519 missense probably damaging 1.00
R9237:Mttp UTSW 3 138104683 missense probably benign
R9427:Mttp UTSW 3 138115201 missense probably benign 0.01
Z1176:Mttp UTSW 3 138104779 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTCTAACTAGCAGATTCTGGTAC -3'
(R):5'- TGGAGCTGTGACTGAGTTCC -3'

Sequencing Primer
(F):5'- ATATCTGTACCTGTATCTGTAGCTG -3'
(R):5'- GCTGTGACTGAGTTCCACCCC -3'
Posted On 2021-03-08