Incidental Mutation 'R8677:Miip'
ID661436
Institutional Source Beutler Lab
Gene Symbol Miip
Ensembl Gene ENSMUSG00000029022
Gene Namemigration and invasion inhibitory protein
SynonymsD4Wsu114e
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R8677 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location147860778-147868816 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 147863046 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 219 (C219Y)
Ref Sequence ENSEMBL: ENSMUSP00000113897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030886] [ENSMUST00000119975] [ENSMUST00000172710]
Predicted Effect probably damaging
Transcript: ENSMUST00000030886
AA Change: C219Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030886
Gene: ENSMUSG00000029022
AA Change: C219Y

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119975
AA Change: C219Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113897
Gene: ENSMUSG00000029022
AA Change: C219Y

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Pfam:MIIP 41 382 1.4e-142 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172710
AA Change: C219Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134085
Gene: ENSMUSG00000029022
AA Change: C219Y

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the oncogene protein insulin-like growth factor binding protein 2 and may function as an inhibitor of cell migration and invasion. This protein also interacts with the cell division protein 20 and may be involved in regulating mitotic progression. This protein may function as a tumor suppressor by inhibiting the growth or certain cancers. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,595,471 D474G probably benign Het
1190007I07Rik G T 10: 82,620,216 T37K possibly damaging Het
2610507B11Rik C T 11: 78,284,156 R1706C probably damaging Het
Acd A C 8: 105,700,944 S25R probably damaging Het
Acly A T 11: 100,519,743 H136Q probably damaging Het
Adrm1 C T 2: 180,172,039 T2M probably benign Het
Ankrd12 A T 17: 66,024,214 L246M probably damaging Het
Cacnb3 T C 15: 98,642,050 L258P probably damaging Het
Ccdc129 A G 6: 55,872,594 H37R probably benign Het
Cd36 C T 5: 17,820,495 V76M probably damaging Het
Cep120 A G 18: 53,738,561 F80L possibly damaging Het
Clcn1 A T 6: 42,290,585 probably null Het
Col17a1 T C 19: 47,651,801 T1042A probably benign Het
Comp A T 8: 70,380,260 N623Y probably damaging Het
Ctnnal1 A G 4: 56,813,272 L653P probably benign Het
Cx3cl1 G T 8: 94,779,815 R149S probably benign Het
Dbndd2 T A 2: 164,488,602 N58K probably damaging Het
Dclk1 A G 3: 55,502,419 I595V probably damaging Het
Dhx15 T C 5: 52,184,544 D144G probably benign Het
Dlat T C 9: 50,658,707 E120G probably damaging Het
Fam171a1 T A 2: 3,220,315 Y273N probably damaging Het
Fndc3b A T 3: 27,457,027 V778D probably benign Het
Grn T C 11: 102,433,567 S129P possibly damaging Het
Grxcr1 T C 5: 68,110,414 F169L possibly damaging Het
Hcn2 A G 10: 79,724,785 I317V probably benign Het
Heca T C 10: 17,915,676 N211D probably benign Het
Htr1f T C 16: 64,926,051 T293A possibly damaging Het
Ifitm10 T A 7: 142,356,012 I116F probably benign Het
Ivl A T 3: 92,572,679 D26E probably benign Het
Kcnma1 T A 14: 23,386,350 E761V probably benign Het
Ltbp1 G T 17: 75,348,758 V923F probably benign Het
Mfsd4b2 A T 10: 39,923,809 F32L probably benign Het
Micu2 T C 14: 57,923,963 R301G possibly damaging Het
Mn1 T A 5: 111,419,019 L285* probably null Het
Mthfd1l T A 10: 4,048,250 N664K possibly damaging Het
Mttp A T 3: 138,104,676 H659Q probably benign Het
Myadml2 G A 11: 120,647,989 P7S probably benign Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Nlrp4c C T 7: 6,072,645 T645I probably damaging Het
Notch1 C T 2: 26,469,924 V1260I probably damaging Het
Numa1 T C 7: 102,000,941 L1293P probably damaging Het
Olfr403 A T 11: 74,195,589 I29F probably benign Het
Olfr684 A G 7: 105,157,568 L38P probably benign Het
Pcdh12 G T 18: 38,282,138 H645N probably benign Het
Pdcd1 A T 1: 94,041,227 L122H probably damaging Het
Pknox2 G A 9: 36,910,591 P246L probably damaging Het
Polr2a A T 11: 69,735,555 S1590T possibly damaging Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
Proser1 A G 3: 53,477,701 T335A probably benign Het
Ptprc A G 1: 138,083,597 I598T probably damaging Het
Rasal3 T C 17: 32,396,854 T337A probably benign Het
Rasgrp3 A T 17: 75,512,060 T415S probably benign Het
Rbm7 T A 9: 48,489,973 R152* probably null Het
Sf3b2 C T 19: 5,286,229 R513H probably damaging Het
Slc22a30 A G 19: 8,386,671 S214P probably benign Het
Spam1 A G 6: 24,796,985 T312A probably benign Het
Ssh2 A G 11: 77,455,193 T1335A possibly damaging Het
Tef T A 15: 81,814,968 L59Q probably damaging Het
Tmem131l A C 3: 83,928,702 V700G probably damaging Het
Twsg1 A G 17: 65,926,407 S183P probably damaging Het
Unc13c T C 9: 73,932,961 T203A probably benign Het
Vmn2r75 G T 7: 86,165,202 P361Q possibly damaging Het
Xirp2 A T 2: 67,516,634 N3073I probably damaging Het
Zfp114 A G 7: 24,180,645 N140D probably benign Het
Other mutations in Miip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Miip APN 4 147865865 missense probably damaging 1.00
IGL02134:Miip APN 4 147865278 splice site probably benign
IGL02829:Miip APN 4 147863061 missense probably benign 0.01
IGL03350:Miip APN 4 147862522 missense probably benign 0.01
R0200:Miip UTSW 4 147862263 missense probably damaging 0.99
R1647:Miip UTSW 4 147865234 missense probably benign 0.02
R1783:Miip UTSW 4 147865774 missense probably damaging 1.00
R1848:Miip UTSW 4 147863092 missense probably damaging 0.99
R1944:Miip UTSW 4 147865965 missense probably benign 0.15
R3615:Miip UTSW 4 147865914 missense probably benign 0.00
R3616:Miip UTSW 4 147865914 missense probably benign 0.00
R3882:Miip UTSW 4 147861052 missense possibly damaging 0.93
R4579:Miip UTSW 4 147861061 missense probably damaging 1.00
R5183:Miip UTSW 4 147863069 missense probably damaging 1.00
R6054:Miip UTSW 4 147865678 missense probably benign 0.00
R6056:Miip UTSW 4 147862335 missense probably damaging 1.00
R6304:Miip UTSW 4 147863083 missense probably benign 0.12
R6568:Miip UTSW 4 147865915 missense probably benign
R6603:Miip UTSW 4 147865923 missense possibly damaging 0.92
R7639:Miip UTSW 4 147862564 missense probably benign 0.22
R7701:Miip UTSW 4 147862914 missense probably null 0.86
R7795:Miip UTSW 4 147862918 missense probably benign 0.17
R7796:Miip UTSW 4 147862918 missense probably benign 0.17
R7797:Miip UTSW 4 147862918 missense probably benign 0.17
R7872:Miip UTSW 4 147862918 missense probably benign 0.17
R7920:Miip UTSW 4 147862918 missense probably benign 0.17
R8468:Miip UTSW 4 147861471 missense probably damaging 1.00
R8492:Miip UTSW 4 147861424 missense probably damaging 1.00
R8852:Miip UTSW 4 147866382 start gained probably benign
R8860:Miip UTSW 4 147866382 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGCTTAGATACCAGGCTGCC -3'
(R):5'- TGGTGCACAAACAGAGCTGG -3'

Sequencing Primer
(F):5'- TTCCTGAGTCCACAGCTCAGAG -3'
(R):5'- CTGGCACTAACAGAGGGTG -3'
Posted On2021-03-08