Incidental Mutation 'R8677:Cd36'
ID 661437
Institutional Source Beutler Lab
Gene Symbol Cd36
Ensembl Gene ENSMUSG00000002944
Gene Name CD36 molecule
Synonyms fatty acid translocase, FAT, Scarb3
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.128) question?
Stock # R8677 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 17781690-17888801 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 17820495 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 76 (V76M)
Ref Sequence ENSEMBL: ENSMUSP00000080974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082367] [ENSMUST00000165232] [ENSMUST00000169095] [ENSMUST00000170051] [ENSMUST00000197574] [ENSMUST00000197890]
AlphaFold Q08857
Predicted Effect probably damaging
Transcript: ENSMUST00000082367
AA Change: V76M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080974
Gene: ENSMUSG00000002944
AA Change: V76M

DomainStartEndE-ValueType
Pfam:CD36 14 463 2.5e-151 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165232
AA Change: V76M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126300
Gene: ENSMUSG00000002944
AA Change: V76M

DomainStartEndE-ValueType
Pfam:CD36 12 465 2.5e-149 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169095
AA Change: V76M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131832
Gene: ENSMUSG00000002944
AA Change: V76M

DomainStartEndE-ValueType
Pfam:CD36 12 465 2.5e-149 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170051
AA Change: V76M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133008
Gene: ENSMUSG00000002944
AA Change: V76M

DomainStartEndE-ValueType
Pfam:CD36 12 465 2.5e-149 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000197574
AA Change: V76M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143107
Gene: ENSMUSG00000002944
AA Change: V76M

DomainStartEndE-ValueType
Pfam:CD36 12 142 1.8e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000197890
AA Change: V76M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143061
Gene: ENSMUSG00000002944
AA Change: V76M

DomainStartEndE-ValueType
Pfam:CD36 12 465 2.5e-149 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the fourth major glycoprotein of the platelet surface and serves as a receptor for thrombospondin in platelets and various cell lines. Since thrombospondins are widely distributed proteins involved in a variety of adhesive processes, this protein may have important functions as a cell adhesion molecule. It binds to collagen, thrombospondin, anionic phospholipids and oxidized LDL. It directly mediates cytoadherence of Plasmodium falciparum parasitized erythrocytes and it binds long chain fatty acids and may function in the transport and/or as a regulator of fatty acid transport. Mutations in this gene cause platelet glycoprotein deficiency. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutant mice exhibit an immunodeficiency phenotype, are susceptible to S. aureus infection and develop ocular pterygium. Mice homozygous for disruptions in this gene display abnormal lipid homeostasis which affects energy utilization in the heart. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,595,471 D474G probably benign Het
1190007I07Rik G T 10: 82,620,216 T37K possibly damaging Het
2610507B11Rik C T 11: 78,284,156 R1706C probably damaging Het
Acd A C 8: 105,700,944 S25R probably damaging Het
Acly A T 11: 100,519,743 H136Q probably damaging Het
Adrm1 C T 2: 180,172,039 T2M probably benign Het
Ankrd12 A T 17: 66,024,214 L246M probably damaging Het
Cacnb3 T C 15: 98,642,050 L258P probably damaging Het
Ccdc129 A G 6: 55,872,594 H37R probably benign Het
Cep120 A G 18: 53,738,561 F80L possibly damaging Het
Clcn1 A T 6: 42,290,585 probably null Het
Col17a1 T C 19: 47,651,801 T1042A probably benign Het
Comp A T 8: 70,380,260 N623Y probably damaging Het
Ctnnal1 A G 4: 56,813,272 L653P probably benign Het
Cx3cl1 G T 8: 94,779,815 R149S probably benign Het
Dbndd2 T A 2: 164,488,602 N58K probably damaging Het
Dclk1 A G 3: 55,502,419 I595V probably damaging Het
Dhx15 T C 5: 52,184,544 D144G probably benign Het
Dlat T C 9: 50,658,707 E120G probably damaging Het
Fam171a1 T A 2: 3,220,315 Y273N probably damaging Het
Fndc3b A T 3: 27,457,027 V778D probably benign Het
Grn T C 11: 102,433,567 S129P possibly damaging Het
Grxcr1 T C 5: 68,110,414 F169L possibly damaging Het
Hcn2 A G 10: 79,724,785 I317V probably benign Het
Heca T C 10: 17,915,676 N211D probably benign Het
Htr1f T C 16: 64,926,051 T293A possibly damaging Het
Ifitm10 T A 7: 142,356,012 I116F probably benign Het
Ivl A T 3: 92,572,679 D26E probably benign Het
Kcnma1 T A 14: 23,386,350 E761V probably benign Het
Ltbp1 G T 17: 75,348,758 V923F probably benign Het
Mfsd4b2 A T 10: 39,923,809 F32L probably benign Het
Micu2 T C 14: 57,923,963 R301G possibly damaging Het
Miip C T 4: 147,863,046 C219Y probably damaging Het
Mn1 T A 5: 111,419,019 L285* probably null Het
Mthfd1l T A 10: 4,048,250 N664K possibly damaging Het
Mttp A T 3: 138,104,676 H659Q probably benign Het
Myadml2 G A 11: 120,647,989 P7S probably benign Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Nlrp4c C T 7: 6,072,645 T645I probably damaging Het
Notch1 C T 2: 26,469,924 V1260I probably damaging Het
Numa1 T C 7: 102,000,941 L1293P probably damaging Het
Olfr403 A T 11: 74,195,589 I29F probably benign Het
Olfr684 A G 7: 105,157,568 L38P probably benign Het
Pcdh12 G T 18: 38,282,138 H645N probably benign Het
Pdcd1 A T 1: 94,041,227 L122H probably damaging Het
Pknox2 G A 9: 36,910,591 P246L probably damaging Het
Polr2a A T 11: 69,735,555 S1590T possibly damaging Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
Proser1 A G 3: 53,477,701 T335A probably benign Het
Ptprc A G 1: 138,083,597 I598T probably damaging Het
Rasal3 T C 17: 32,396,854 T337A probably benign Het
Rasgrp3 A T 17: 75,512,060 T415S probably benign Het
Rbm7 T A 9: 48,489,973 R152* probably null Het
Sf3b2 C T 19: 5,286,229 R513H probably damaging Het
Slc22a30 A G 19: 8,386,671 S214P probably benign Het
Spam1 A G 6: 24,796,985 T312A probably benign Het
Ssh2 A G 11: 77,455,193 T1335A possibly damaging Het
Tef T A 15: 81,814,968 L59Q probably damaging Het
Tmem131l A C 3: 83,928,702 V700G probably damaging Het
Twsg1 A G 17: 65,926,407 S183P probably damaging Het
Unc13c T C 9: 73,932,961 T203A probably benign Het
Vmn2r75 G T 7: 86,165,202 P361Q possibly damaging Het
Xirp2 A T 2: 67,516,634 N3073I probably damaging Het
Zfp114 A G 7: 24,180,645 N140D probably benign Het
Other mutations in Cd36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Cd36 APN 5 17787702 missense probably damaging 0.99
IGL01355:Cd36 APN 5 17813074 missense possibly damaging 0.76
IGL02140:Cd36 APN 5 17828768 splice site probably benign
IGL02385:Cd36 APN 5 17814719 missense probably benign 0.31
IGL02626:Cd36 APN 5 17797128 nonsense probably null
IGL02645:Cd36 APN 5 17785880 missense probably benign 0.01
IGL03149:Cd36 APN 5 17820565 missense probably benign 0.02
detached UTSW 5 17814723 missense probably damaging 1.00
oblivious UTSW 5 17874966 intron probably benign
E0370:Cd36 UTSW 5 17785749 nonsense probably null
F5770:Cd36 UTSW 5 17820528 frame shift probably null
R0266:Cd36 UTSW 5 17798252 missense probably benign 0.09
R1102:Cd36 UTSW 5 17814213 missense possibly damaging 0.79
R1120:Cd36 UTSW 5 17785828 missense possibly damaging 0.67
R1170:Cd36 UTSW 5 17813088 missense probably damaging 1.00
R1551:Cd36 UTSW 5 17797122 missense probably benign 0.00
R1918:Cd36 UTSW 5 17797036 nonsense probably null
R4090:Cd36 UTSW 5 17785720 critical splice donor site probably null
R4197:Cd36 UTSW 5 17813088 missense probably damaging 1.00
R5602:Cd36 UTSW 5 17814792 missense possibly damaging 0.94
R5647:Cd36 UTSW 5 17814765 missense probably damaging 1.00
R5867:Cd36 UTSW 5 17785735 missense probably benign 0.05
R6151:Cd36 UTSW 5 17795595 missense probably damaging 1.00
R6400:Cd36 UTSW 5 17814723 missense probably damaging 1.00
R6419:Cd36 UTSW 5 17797152 missense probably benign
R7081:Cd36 UTSW 5 17814704 missense probably damaging 1.00
R7195:Cd36 UTSW 5 17814189 missense probably damaging 1.00
R7420:Cd36 UTSW 5 17788274 missense probably benign 0.09
R9460:Cd36 UTSW 5 17795610 missense probably null 0.10
R9526:Cd36 UTSW 5 17797035 missense probably damaging 0.99
R9747:Cd36 UTSW 5 17814734 missense probably benign 0.19
V7580:Cd36 UTSW 5 17820528 frame shift probably null
Z1088:Cd36 UTSW 5 17795575 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACACTTGGGTAGCACATATAGATAG -3'
(R):5'- CACAGGCAGTCCTTTTATTTTGAC -3'

Sequencing Primer
(F):5'- CTTGTAGGGAAAACATTTTGATGTG -3'
(R):5'- GGCAGTCCTTTTATTTTGACTAAAC -3'
Posted On 2021-03-08