Mutagenetix > Incidental Mutation

Incidental Mutation 'R8677:Cd36'

661437

Institutional Source

Beutler Lab

Gene Symbol

Cd36

Ensembl Gene

ENSMUSG00000002944

Gene Name

CD36 molecule

Synonyms

fatty acid translocase, FAT, Scarb3

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.128) question?

Stock #

R8677 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

17781690-17888801 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 17820495 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 76 (V76M)

Ref Sequence

ENSEMBL: ENSMUSP00000080974 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082367] [ENSMUST00000165232] [ENSMUST00000169095] [ENSMUST00000170051] [ENSMUST00000197574] [ENSMUST00000197890]

AlphaFold

Q08857

Predicted Effect

probably damaging
Transcript: ENSMUST00000082367
AA Change: V76M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000080974
Gene: ENSMUSG00000002944
AA Change: V76M

Domain	Start	End	E-Value	Type
Pfam:CD36	14	463	2.5e-151	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000165232
AA Change: V76M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126300
Gene: ENSMUSG00000002944
AA Change: V76M

Domain	Start	End	E-Value	Type
Pfam:CD36	12	465	2.5e-149	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000169095
AA Change: V76M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131832
Gene: ENSMUSG00000002944
AA Change: V76M

Domain	Start	End	E-Value	Type
Pfam:CD36	12	465	2.5e-149	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000170051
AA Change: V76M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133008
Gene: ENSMUSG00000002944
AA Change: V76M

Domain	Start	End	E-Value	Type
Pfam:CD36	12	465	2.5e-149	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000197574
AA Change: V76M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143107
Gene: ENSMUSG00000002944
AA Change: V76M

Domain	Start	End	E-Value	Type
Pfam:CD36	12	142	1.8e-36	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000197890
AA Change: V76M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143061
Gene: ENSMUSG00000002944
AA Change: V76M

Domain	Start	End	E-Value	Type
Pfam:CD36	12	465	2.5e-149	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the fourth major glycoprotein of the platelet surface and serves as a receptor for thrombospondin in platelets and various cell lines. Since thrombospondins are widely distributed proteins involved in a variety of adhesive processes, this protein may have important functions as a cell adhesion molecule. It binds to collagen, thrombospondin, anionic phospholipids and oxidized LDL. It directly mediates cytoadherence of Plasmodium falciparum parasitized erythrocytes and it binds long chain fatty acids and may function in the transport and/or as a regulator of fatty acid transport. Mutations in this gene cause platelet glycoprotein deficiency. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutant mice exhibit an immunodeficiency phenotype, are susceptible to S. aureus infection and develop ocular pterygium. Mice homozygous for disruptions in this gene display abnormal lipid homeostasis which affects energy utilization in the heart. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	T	C	11: 23,595,471	D474G	probably benign	Het
1190007I07Rik	G	T	10: 82,620,216	T37K	possibly damaging	Het
2610507B11Rik	C	T	11: 78,284,156	R1706C	probably damaging	Het
Acd	A	C	8: 105,700,944	S25R	probably damaging	Het
Acly	A	T	11: 100,519,743	H136Q	probably damaging	Het
Adrm1	C	T	2: 180,172,039	T2M	probably benign	Het
Ankrd12	A	T	17: 66,024,214	L246M	probably damaging	Het
Cacnb3	T	C	15: 98,642,050	L258P	probably damaging	Het
Ccdc129	A	G	6: 55,872,594	H37R	probably benign	Het
Cep120	A	G	18: 53,738,561	F80L	possibly damaging	Het
Clcn1	A	T	6: 42,290,585		probably null	Het
Col17a1	T	C	19: 47,651,801	T1042A	probably benign	Het
Comp	A	T	8: 70,380,260	N623Y	probably damaging	Het
Ctnnal1	A	G	4: 56,813,272	L653P	probably benign	Het
Cx3cl1	G	T	8: 94,779,815	R149S	probably benign	Het
Dbndd2	T	A	2: 164,488,602	N58K	probably damaging	Het
Dclk1	A	G	3: 55,502,419	I595V	probably damaging	Het
Dhx15	T	C	5: 52,184,544	D144G	probably benign	Het
Dlat	T	C	9: 50,658,707	E120G	probably damaging	Het
Fam171a1	T	A	2: 3,220,315	Y273N	probably damaging	Het
Fndc3b	A	T	3: 27,457,027	V778D	probably benign	Het
Grn	T	C	11: 102,433,567	S129P	possibly damaging	Het
Grxcr1	T	C	5: 68,110,414	F169L	possibly damaging	Het
Hcn2	A	G	10: 79,724,785	I317V	probably benign	Het
Heca	T	C	10: 17,915,676	N211D	probably benign	Het
Htr1f	T	C	16: 64,926,051	T293A	possibly damaging	Het
Ifitm10	T	A	7: 142,356,012	I116F	probably benign	Het
Ivl	A	T	3: 92,572,679	D26E	probably benign	Het
Kcnma1	T	A	14: 23,386,350	E761V	probably benign	Het
Ltbp1	G	T	17: 75,348,758	V923F	probably benign	Het
Mfsd4b2	A	T	10: 39,923,809	F32L	probably benign	Het
Micu2	T	C	14: 57,923,963	R301G	possibly damaging	Het
Miip	C	T	4: 147,863,046	C219Y	probably damaging	Het
Mn1	T	A	5: 111,419,019	L285*	probably null	Het
Mthfd1l	T	A	10: 4,048,250	N664K	possibly damaging	Het
Mttp	A	T	3: 138,104,676	H659Q	probably benign	Het
Myadml2	G	A	11: 120,647,989	P7S	probably benign	Het
Nlgn3	T	C	X: 101,308,784	V179A	probably damaging	Het
Nlrp4c	C	T	7: 6,072,645	T645I	probably damaging	Het
Notch1	C	T	2: 26,469,924	V1260I	probably damaging	Het
Numa1	T	C	7: 102,000,941	L1293P	probably damaging	Het
Olfr403	A	T	11: 74,195,589	I29F	probably benign	Het
Olfr684	A	G	7: 105,157,568	L38P	probably benign	Het
Pcdh12	G	T	18: 38,282,138	H645N	probably benign	Het
Pdcd1	A	T	1: 94,041,227	L122H	probably damaging	Het
Pknox2	G	A	9: 36,910,591	P246L	probably damaging	Het
Polr2a	A	T	11: 69,735,555	S1590T	possibly damaging	Het
Ppp1r16b	G	A	2: 158,751,178	D226N	probably damaging	Het
Proser1	A	G	3: 53,477,701	T335A	probably benign	Het
Ptprc	A	G	1: 138,083,597	I598T	probably damaging	Het
Rasal3	T	C	17: 32,396,854	T337A	probably benign	Het
Rasgrp3	A	T	17: 75,512,060	T415S	probably benign	Het
Rbm7	T	A	9: 48,489,973	R152*	probably null	Het
Sf3b2	C	T	19: 5,286,229	R513H	probably damaging	Het
Slc22a30	A	G	19: 8,386,671	S214P	probably benign	Het
Spam1	A	G	6: 24,796,985	T312A	probably benign	Het
Ssh2	A	G	11: 77,455,193	T1335A	possibly damaging	Het
Tef	T	A	15: 81,814,968	L59Q	probably damaging	Het
Tmem131l	A	C	3: 83,928,702	V700G	probably damaging	Het
Twsg1	A	G	17: 65,926,407	S183P	probably damaging	Het
Unc13c	T	C	9: 73,932,961	T203A	probably benign	Het
Vmn2r75	G	T	7: 86,165,202	P361Q	possibly damaging	Het
Xirp2	A	T	2: 67,516,634	N3073I	probably damaging	Het
Zfp114	A	G	7: 24,180,645	N140D	probably benign	Het

Other mutations in Cd36

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00529:Cd36	APN	5	17787702	missense	probably damaging	0.99
IGL01355:Cd36	APN	5	17813074	missense	possibly damaging	0.76
IGL02140:Cd36	APN	5	17828768	splice site	probably benign
IGL02385:Cd36	APN	5	17814719	missense	probably benign	0.31
IGL02626:Cd36	APN	5	17797128	nonsense	probably null
IGL02645:Cd36	APN	5	17785880	missense	probably benign	0.01
IGL03149:Cd36	APN	5	17820565	missense	probably benign	0.02
detached	UTSW	5	17814723	missense	probably damaging	1.00
oblivious	UTSW	5	17874966	intron	probably benign
E0370:Cd36	UTSW	5	17785749	nonsense	probably null
F5770:Cd36	UTSW	5	17820528	frame shift	probably null
R0266:Cd36	UTSW	5	17798252	missense	probably benign	0.09
R1102:Cd36	UTSW	5	17814213	missense	possibly damaging	0.79
R1120:Cd36	UTSW	5	17785828	missense	possibly damaging	0.67
R1170:Cd36	UTSW	5	17813088	missense	probably damaging	1.00
R1551:Cd36	UTSW	5	17797122	missense	probably benign	0.00
R1918:Cd36	UTSW	5	17797036	nonsense	probably null
R4090:Cd36	UTSW	5	17785720	critical splice donor site	probably null
R4197:Cd36	UTSW	5	17813088	missense	probably damaging	1.00
R5602:Cd36	UTSW	5	17814792	missense	possibly damaging	0.94
R5647:Cd36	UTSW	5	17814765	missense	probably damaging	1.00
R5867:Cd36	UTSW	5	17785735	missense	probably benign	0.05
R6151:Cd36	UTSW	5	17795595	missense	probably damaging	1.00
R6400:Cd36	UTSW	5	17814723	missense	probably damaging	1.00
R6419:Cd36	UTSW	5	17797152	missense	probably benign
R7081:Cd36	UTSW	5	17814704	missense	probably damaging	1.00
R7195:Cd36	UTSW	5	17814189	missense	probably damaging	1.00
R7420:Cd36	UTSW	5	17788274	missense	probably benign	0.09
R9460:Cd36	UTSW	5	17795610	missense	probably null	0.10
R9526:Cd36	UTSW	5	17797035	missense	probably damaging	0.99
R9747:Cd36	UTSW	5	17814734	missense	probably benign	0.19
V7580:Cd36	UTSW	5	17820528	frame shift	probably null
Z1088:Cd36	UTSW	5	17795575	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- ACACTTGGGTAGCACATATAGATAG -3'
(R):5'- CACAGGCAGTCCTTTTATTTTGAC -3'

Sequencing Primer
(F):5'- CTTGTAGGGAAAACATTTTGATGTG -3'
(R):5'- GGCAGTCCTTTTATTTTGACTAAAC -3'

Posted On

2021-03-08