Incidental Mutation 'R8677:Dhx15'
ID661438
Institutional Source Beutler Lab
Gene Symbol Dhx15
Ensembl Gene ENSMUSG00000029169
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 15
SynonymsDdx15, HRH2, DBP1, mDEAH9
Accession Numbers

Genbank: NM_001042620, NM_007839; MGI: 1099786

Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R8677 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location52150203-52190514 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52184544 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 144 (D144G)
Ref Sequence ENSEMBL: ENSMUSP00000031061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031061] [ENSMUST00000195922] [ENSMUST00000199321] [ENSMUST00000200186]
Predicted Effect probably benign
Transcript: ENSMUST00000031061
AA Change: D144G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031061
Gene: ENSMUSG00000029169
AA Change: D144G

DomainStartEndE-ValueType
low complexity region 23 60 N/A INTRINSIC
low complexity region 79 110 N/A INTRINSIC
DEXDc 135 322 4.11e-32 SMART
AAA 152 326 1.07e-2 SMART
HELICc 363 477 1.06e-16 SMART
HA2 538 628 2.76e-31 SMART
Pfam:OB_NTP_bind 662 765 3.1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195922
SMART Domains Protein: ENSMUSP00000143658
Gene: ENSMUSG00000029169

DomainStartEndE-ValueType
SCOP:d1jpna2 20 149 7e-17 SMART
Blast:AAA 24 186 4e-68 BLAST
PDB:3KX2|A 25 186 4e-65 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000199321
AA Change: D144G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143069
Gene: ENSMUSG00000029169
AA Change: D144G

DomainStartEndE-ValueType
low complexity region 23 60 N/A INTRINSIC
low complexity region 79 110 N/A INTRINSIC
DEXDc 135 322 4.11e-32 SMART
AAA 152 326 1.07e-2 SMART
HELICc 363 477 1.06e-16 SMART
HA2 538 628 2.76e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200186
AA Change: D144G

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000143381
Gene: ENSMUSG00000029169
AA Change: D144G

DomainStartEndE-ValueType
low complexity region 23 60 N/A INTRINSIC
low complexity region 79 110 N/A INTRINSIC
DEXDc 135 322 1.7e-34 SMART
AAA 152 326 1.7e-4 SMART
HELICc 363 477 4.3e-19 SMART
HA2 538 608 4.6e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative ATP-dependent RNA helicase implicated in pre-mRNA splicing. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(24) : Gene trapped(24)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,595,471 D474G probably benign Het
1190007I07Rik G T 10: 82,620,216 T37K possibly damaging Het
2610507B11Rik C T 11: 78,284,156 R1706C probably damaging Het
Acd A C 8: 105,700,944 S25R probably damaging Het
Acly A T 11: 100,519,743 H136Q probably damaging Het
Adrm1 C T 2: 180,172,039 T2M probably benign Het
Ankrd12 A T 17: 66,024,214 L246M probably damaging Het
Cacnb3 T C 15: 98,642,050 L258P probably damaging Het
Ccdc129 A G 6: 55,872,594 H37R probably benign Het
Cd36 C T 5: 17,820,495 V76M probably damaging Het
Cep120 A G 18: 53,738,561 F80L possibly damaging Het
Clcn1 A T 6: 42,290,585 probably null Het
Col17a1 T C 19: 47,651,801 T1042A probably benign Het
Comp A T 8: 70,380,260 N623Y probably damaging Het
Ctnnal1 A G 4: 56,813,272 L653P probably benign Het
Cx3cl1 G T 8: 94,779,815 R149S probably benign Het
Dbndd2 T A 2: 164,488,602 N58K probably damaging Het
Dclk1 A G 3: 55,502,419 I595V probably damaging Het
Dlat T C 9: 50,658,707 E120G probably damaging Het
Fam171a1 T A 2: 3,220,315 Y273N probably damaging Het
Fndc3b A T 3: 27,457,027 V778D probably benign Het
Grn T C 11: 102,433,567 S129P possibly damaging Het
Grxcr1 T C 5: 68,110,414 F169L possibly damaging Het
Hcn2 A G 10: 79,724,785 I317V probably benign Het
Heca T C 10: 17,915,676 N211D probably benign Het
Htr1f T C 16: 64,926,051 T293A possibly damaging Het
Ifitm10 T A 7: 142,356,012 I116F probably benign Het
Ivl A T 3: 92,572,679 D26E probably benign Het
Kcnma1 T A 14: 23,386,350 E761V probably benign Het
Ltbp1 G T 17: 75,348,758 V923F probably benign Het
Mfsd4b2 A T 10: 39,923,809 F32L probably benign Het
Micu2 T C 14: 57,923,963 R301G possibly damaging Het
Miip C T 4: 147,863,046 C219Y probably damaging Het
Mn1 T A 5: 111,419,019 L285* probably null Het
Mthfd1l T A 10: 4,048,250 N664K possibly damaging Het
Mttp A T 3: 138,104,676 H659Q probably benign Het
Myadml2 G A 11: 120,647,989 P7S probably benign Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Nlrp4c C T 7: 6,072,645 T645I probably damaging Het
Notch1 C T 2: 26,469,924 V1260I probably damaging Het
Numa1 T C 7: 102,000,941 L1293P probably damaging Het
Olfr403 A T 11: 74,195,589 I29F probably benign Het
Olfr684 A G 7: 105,157,568 L38P probably benign Het
Pcdh12 G T 18: 38,282,138 H645N probably benign Het
Pdcd1 A T 1: 94,041,227 L122H probably damaging Het
Pknox2 G A 9: 36,910,591 P246L probably damaging Het
Polr2a A T 11: 69,735,555 S1590T possibly damaging Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
Proser1 A G 3: 53,477,701 T335A probably benign Het
Ptprc A G 1: 138,083,597 I598T probably damaging Het
Rasal3 T C 17: 32,396,854 T337A probably benign Het
Rasgrp3 A T 17: 75,512,060 T415S probably benign Het
Rbm7 T A 9: 48,489,973 R152* probably null Het
Sf3b2 C T 19: 5,286,229 R513H probably damaging Het
Slc22a30 A G 19: 8,386,671 S214P probably benign Het
Spam1 A G 6: 24,796,985 T312A probably benign Het
Ssh2 A G 11: 77,455,193 T1335A possibly damaging Het
Tef T A 15: 81,814,968 L59Q probably damaging Het
Tmem131l A C 3: 83,928,702 V700G probably damaging Het
Twsg1 A G 17: 65,926,407 S183P probably damaging Het
Unc13c T C 9: 73,932,961 T203A probably benign Het
Vmn2r75 G T 7: 86,165,202 P361Q possibly damaging Het
Xirp2 A T 2: 67,516,634 N3073I probably damaging Het
Zfp114 A G 7: 24,180,645 N140D probably benign Het
Other mutations in Dhx15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dhx15 APN 5 52166775 missense probably damaging 1.00
IGL00392:Dhx15 APN 5 52157582 splice site probably benign
IGL00484:Dhx15 APN 5 52166812 missense probably benign
IGL00691:Dhx15 APN 5 52170093 missense probably damaging 1.00
IGL01014:Dhx15 APN 5 52151924 missense probably damaging 1.00
IGL02808:Dhx15 APN 5 52161699 missense possibly damaging 0.95
IGL03408:Dhx15 APN 5 52160312 missense probably damaging 1.00
3-1:Dhx15 UTSW 5 52166697 splice site probably benign
PIT4449001:Dhx15 UTSW 5 52160958 missense probably damaging 0.98
R0021:Dhx15 UTSW 5 52157488 missense probably damaging 0.98
R0133:Dhx15 UTSW 5 52154072 missense possibly damaging 0.61
R0281:Dhx15 UTSW 5 52150746 missense probably benign 0.10
R0566:Dhx15 UTSW 5 52171425 missense probably damaging 1.00
R1827:Dhx15 UTSW 5 52170080 nonsense probably null
R1864:Dhx15 UTSW 5 52184701 missense possibly damaging 0.53
R2106:Dhx15 UTSW 5 52170086 missense probably benign 0.00
R2931:Dhx15 UTSW 5 52166732 missense probably benign 0.01
R2932:Dhx15 UTSW 5 52166732 missense probably benign 0.01
R3762:Dhx15 UTSW 5 52166732 missense probably benign 0.01
R3764:Dhx15 UTSW 5 52166732 missense probably benign 0.01
R3948:Dhx15 UTSW 5 52161580 splice site probably benign
R4452:Dhx15 UTSW 5 52166732 missense probably benign 0.01
R5068:Dhx15 UTSW 5 52170067 missense possibly damaging 0.59
R7031:Dhx15 UTSW 5 52184589 missense probably benign 0.03
R7431:Dhx15 UTSW 5 52162611 missense probably damaging 1.00
R8726:Dhx15 UTSW 5 52154226 missense probably benign 0.01
X0017:Dhx15 UTSW 5 52157490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTACTCTACAAGACAACTGG -3'
(R):5'- TGCTGGATTGCCACCTTTAAAAG -3'

Sequencing Primer
(F):5'- GTACTCTACAAGACAACTGGAAATG -3'
(R):5'- GGATTGCCACCTTTAAAAGCTTCTC -3'
Posted On2021-03-08