Incidental Mutation 'R0238:Tnrc6b'
Institutional Source Beutler Lab
Gene Symbol Tnrc6b
Ensembl Gene ENSMUSG00000047888
Gene Nametrinucleotide repeat containing 6b
MMRRC Submission 038476-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R0238 (G1)
Quality Score138
Status Not validated
Chromosomal Location80711313-80941085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80887864 bp
Amino Acid Change Aspartic acid to Glycine at position 1118 (D1118G)
Ref Sequence ENSEMBL: ENSMUSP00000064336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067689] [ENSMUST00000227449]
Predicted Effect probably damaging
Transcript: ENSMUST00000067689
AA Change: D1118G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888
AA Change: D1118G

low complexity region 7 19 N/A INTRINSIC
coiled coil region 33 72 N/A INTRINSIC
low complexity region 88 106 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
low complexity region 242 260 N/A INTRINSIC
low complexity region 331 346 N/A INTRINSIC
low complexity region 363 380 N/A INTRINSIC
low complexity region 416 425 N/A INTRINSIC
low complexity region 475 487 N/A INTRINSIC
internal_repeat_1 488 667 6.43e-5 PROSPERO
low complexity region 858 888 N/A INTRINSIC
Pfam:Ago_hook 955 1095 1.2e-28 PFAM
coiled coil region 1258 1307 N/A INTRINSIC
Pfam:TNRC6-PABC_bdg 1339 1623 2.8e-112 PFAM
Pfam:RRM_5 1641 1695 2e-7 PFAM
low complexity region 1705 1721 N/A INTRINSIC
low complexity region 1748 1769 N/A INTRINSIC
low complexity region 1792 1809 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228071
Predicted Effect unknown
Transcript: ENSMUST00000228124
AA Change: D265G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228320
Meta Mutation Damage Score 0.2243 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 92.6%
  • 20x: 76.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aar2 T G 2: 156,550,973 V94G probably benign Het
Acp5 A T 9: 22,129,922 S70T possibly damaging Het
Adcy1 C G 11: 7,139,162 N525K possibly damaging Het
AI464131 A T 4: 41,498,912 N239K probably benign Het
Aknad1 A G 3: 108,781,239 M628V probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Cacna1d A G 14: 30,123,496 V572A probably benign Het
Ccdc158 A C 5: 92,662,118 M177R probably benign Het
Ccdc191 A T 16: 43,947,496 R678* probably null Het
Cdkn2d C A 9: 21,290,992 probably benign Het
Cdx2 G T 5: 147,303,287 T193K probably damaging Het
Cfap44 T A 16: 44,422,318 M695K probably benign Het
Cfap70 A C 14: 20,448,605 S5A probably benign Het
Chd9 T C 8: 90,932,828 S139P probably damaging Het
Chmp7 A G 14: 69,720,997 V241A probably damaging Het
Cnga1 A G 5: 72,605,031 I380T probably damaging Het
Cts6 T A 13: 61,201,819 E53D probably damaging Het
Dclk3 A T 9: 111,482,628 N646I probably damaging Het
Dnhd1 A G 7: 105,721,531 S4673G probably benign Het
Dock4 G T 12: 40,737,540 S818I probably damaging Het
Dysf C T 6: 84,064,479 Q156* probably null Het
Fam163b T C 2: 27,112,634 N117S probably damaging Het
Fam89a A G 8: 124,741,232 Y114H probably damaging Het
Flcn T C 11: 59,801,076 N249S probably benign Het
Gm20422 T C 8: 69,766,715 Y53C probably damaging Het
Gnai1 A G 5: 18,273,550 S206P probably damaging Het
Hal T C 10: 93,503,482 S478P possibly damaging Het
Haus3 G A 5: 34,166,256 P337S possibly damaging Het
Hectd1 T A 12: 51,769,318 M1324L possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Hspa9 A T 18: 34,946,646 Y243* probably null Het
Htr3a T C 9: 48,906,386 T96A probably benign Het
Ift140 C A 17: 25,045,523 C557* probably null Het
Jph3 A G 8: 121,753,720 Q379R possibly damaging Het
Kcnb1 A G 2: 167,104,969 V653A probably benign Het
Kif14 A G 1: 136,527,393 E1551G probably damaging Het
Krt17 G A 11: 100,260,878 R30* probably null Het
Lamb3 A T 1: 193,321,053 D100V probably damaging Het
Map2 A G 1: 66,416,106 D1385G probably damaging Het
Map3k21 A G 8: 125,944,970 D999G possibly damaging Het
Marf1 T C 16: 14,151,283 I109V probably benign Het
Mcam T G 9: 44,140,205 probably null Het
Med18 T C 4: 132,460,026 H99R probably damaging Het
Mettl25 C T 10: 105,826,525 V195I probably damaging Het
Myh8 A G 11: 67,301,692 T1466A probably benign Het
Myo1e A T 9: 70,342,126 I503F possibly damaging Het
Myo3b T A 2: 70,105,425 C61S probably benign Het
Nf1 A T 11: 79,418,574 K438M possibly damaging Het
Nlrp9c A G 7: 26,378,012 S727P possibly damaging Het
Nmbr C T 10: 14,770,395 Q338* probably null Het
Nt5e A G 9: 88,367,332 S440G possibly damaging Het
Nubp2 T C 17: 24,884,471 E144G probably damaging Het
Olfr1126 T C 2: 87,458,037 F291L probably benign Het
Olfr593 G A 7: 103,212,726 V289M possibly damaging Het
Olfr694 A G 7: 106,689,255 Y159H probably benign Het
Otogl T A 10: 107,806,696 N1291I probably damaging Het
Pa2g4 T C 10: 128,563,642 K51R probably benign Het
Pcdhb12 A G 18: 37,436,727 I309V probably benign Het
Pck1 T G 2: 173,157,068 I373S possibly damaging Het
Pga5 A G 19: 10,669,453 Y305H probably damaging Het
Plxnd1 G T 6: 115,968,793 D906E probably benign Het
Ppfia4 T C 1: 134,329,189 E98G possibly damaging Het
Rab39 G A 9: 53,706,030 T29I probably damaging Het
Raet1e C A 10: 22,180,862 H112Q possibly damaging Het
Rars2 T C 4: 34,645,838 Y252H probably damaging Het
Rars2 A C 4: 34,656,030 Q421P probably benign Het
Rasa2 A T 9: 96,568,407 D479E probably damaging Het
Rbl2 A T 8: 91,106,507 T689S probably damaging Het
Rims4 C T 2: 163,864,025 V230M probably benign Het
Skp2 A C 15: 9,127,884 probably null Het
Slc35f4 A T 14: 49,304,256 I347N possibly damaging Het
Slc4a2 A T 5: 24,436,274 probably null Het
Slc52a3 T C 2: 152,008,156 *461Q probably null Het
Slc6a1 G A 6: 114,302,800 V142I probably benign Het
Susd5 A G 9: 114,096,909 *620W probably null Het
Timm21 T C 18: 84,947,666 N239S probably damaging Het
Tmem63c T C 12: 87,075,639 W404R probably damaging Het
Traf2 G C 2: 25,537,126 A71G possibly damaging Het
Trim54 A G 5: 31,134,119 M195V probably benign Het
Trip11 C T 12: 101,884,728 E741K probably damaging Het
Trp73 AGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTG 4: 154,062,524 probably benign Het
Trpm5 G T 7: 143,082,958 T414N probably damaging Het
Vps51 G T 19: 6,071,437 S185* probably null Het
Zfp329 G T 7: 12,810,829 T256K probably damaging Het
Zfp729b A G 13: 67,591,903 Y748H probably damaging Het
Zfp777 T C 6: 48,024,969 E773G probably damaging Het
Other mutations in Tnrc6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Tnrc6b APN 15 80923578 missense probably damaging 1.00
IGL01402:Tnrc6b APN 15 80880544 missense possibly damaging 0.71
IGL01505:Tnrc6b APN 15 80879963 missense probably benign 0.00
IGL01516:Tnrc6b APN 15 80902622 missense possibly damaging 0.93
IGL01584:Tnrc6b APN 15 80879682 missense probably benign 0.01
IGL01681:Tnrc6b APN 15 80879311 splice site probably null
IGL01909:Tnrc6b APN 15 80901983 missense possibly damaging 0.88
IGL01943:Tnrc6b APN 15 80927695 nonsense probably null
IGL02253:Tnrc6b APN 15 80876541 missense probably damaging 0.99
IGL02260:Tnrc6b APN 15 80880171 missense probably damaging 0.99
IGL02437:Tnrc6b APN 15 80880457 missense probably damaging 1.00
IGL02541:Tnrc6b APN 15 80879831 missense probably benign 0.00
IGL02542:Tnrc6b APN 15 80902352 missense possibly damaging 0.83
grosser UTSW 15 80929285 missense probably damaging 1.00
heiliger UTSW 15 80927741 critical splice donor site probably null
PIT1430001:Tnrc6b UTSW 15 80929186 missense probably damaging 0.99
R0092:Tnrc6b UTSW 15 80918528 missense probably damaging 1.00
R0165:Tnrc6b UTSW 15 80858670 splice site probably null
R0238:Tnrc6b UTSW 15 80887864 missense probably damaging 1.00
R0257:Tnrc6b UTSW 15 80894355 missense possibly damaging 0.80
R0418:Tnrc6b UTSW 15 80913323 missense probably benign 0.27
R0432:Tnrc6b UTSW 15 80923446 splice site probably benign
R0487:Tnrc6b UTSW 15 80880675 missense probably benign 0.01
R0498:Tnrc6b UTSW 15 80858719 missense probably damaging 0.98
R0528:Tnrc6b UTSW 15 80879403 missense probably benign 0.00
R0533:Tnrc6b UTSW 15 80876653 missense probably benign 0.00
R0571:Tnrc6b UTSW 15 80913338 missense probably damaging 1.00
R0650:Tnrc6b UTSW 15 80784758 missense probably benign 0.33
R0659:Tnrc6b UTSW 15 80923446 splice site probably benign
R0884:Tnrc6b UTSW 15 80902555 small deletion probably benign
R1131:Tnrc6b UTSW 15 80894453 missense possibly damaging 0.45
R1188:Tnrc6b UTSW 15 80879229 missense probably benign
R1479:Tnrc6b UTSW 15 80887032 splice site probably null
R1564:Tnrc6b UTSW 15 80880168 missense possibly damaging 0.95
R1645:Tnrc6b UTSW 15 80882958 missense probably damaging 0.99
R1924:Tnrc6b UTSW 15 80884206 critical splice acceptor site probably null
R1926:Tnrc6b UTSW 15 80881162 missense probably damaging 1.00
R1928:Tnrc6b UTSW 15 80880723 missense probably damaging 1.00
R1965:Tnrc6b UTSW 15 80880439 missense probably damaging 1.00
R1966:Tnrc6b UTSW 15 80880439 missense probably damaging 1.00
R2072:Tnrc6b UTSW 15 80882965 missense possibly damaging 0.89
R3084:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R3552:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R3736:Tnrc6b UTSW 15 80889163 splice site probably benign
R3791:Tnrc6b UTSW 15 80923640 missense probably damaging 1.00
R4170:Tnrc6b UTSW 15 80916787 missense probably benign 0.24
R4276:Tnrc6b UTSW 15 80901971 missense probably benign 0.42
R4519:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R5380:Tnrc6b UTSW 15 80879565 missense possibly damaging 0.56
R5470:Tnrc6b UTSW 15 80916711 missense possibly damaging 0.89
R5590:Tnrc6b UTSW 15 80876502 missense probably damaging 0.98
R5982:Tnrc6b UTSW 15 80880816 missense probably benign
R6269:Tnrc6b UTSW 15 80880743 missense probably benign 0.42
R6331:Tnrc6b UTSW 15 80879614 missense probably benign 0.00
R6484:Tnrc6b UTSW 15 80879324 missense possibly damaging 0.92
R6622:Tnrc6b UTSW 15 80879184 missense probably damaging 0.99
R6695:Tnrc6b UTSW 15 80879773 missense probably damaging 1.00
R6728:Tnrc6b UTSW 15 80918526 missense probably damaging 1.00
R6776:Tnrc6b UTSW 15 80924119 missense possibly damaging 0.87
R7159:Tnrc6b UTSW 15 80887022 missense possibly damaging 0.92
R7210:Tnrc6b UTSW 15 80929285 missense probably damaging 1.00
R7287:Tnrc6b UTSW 15 80879541 missense possibly damaging 0.83
R7402:Tnrc6b UTSW 15 80884300 missense probably damaging 1.00
R7479:Tnrc6b UTSW 15 80889126 missense probably benign 0.13
R7533:Tnrc6b UTSW 15 80927741 critical splice donor site probably null
R7571:Tnrc6b UTSW 15 80929393 missense probably benign
R7594:Tnrc6b UTSW 15 80880307 missense possibly damaging 0.66
R7831:Tnrc6b UTSW 15 80880379 missense possibly damaging 0.49
R8208:Tnrc6b UTSW 15 80858700 missense possibly damaging 0.53
R8276:Tnrc6b UTSW 15 80880717 missense probably benign 0.00
R8295:Tnrc6b UTSW 15 80913364 missense probably damaging 1.00
R8351:Tnrc6b UTSW 15 80923490 missense probably damaging 0.99
R8423:Tnrc6b UTSW 15 80929418 missense unknown
R8451:Tnrc6b UTSW 15 80923490 missense probably damaging 0.99
R8725:Tnrc6b UTSW 15 80876452 missense probably damaging 1.00
X0020:Tnrc6b UTSW 15 80882997 missense probably benign 0.16
X0025:Tnrc6b UTSW 15 80881167 missense probably benign 0.03
Z1088:Tnrc6b UTSW 15 80927690 nonsense probably null
Z1177:Tnrc6b UTSW 15 80858699 missense possibly damaging 0.68
Predicted Primers
Posted On2013-08-19