Incidental Mutation 'R0238:Marf1'
Institutional Source Beutler Lab
Gene Symbol Marf1
Ensembl Gene ENSMUSG00000060657
Gene Namemeiosis regulator and mRNA stability 1
MMRRC Submission 038476-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R0238 (G1)
Quality Score225
Status Not validated
Chromosomal Location14109173-14163351 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14151283 bp
Amino Acid Change Isoleucine to Valine at position 109 (I109V)
Ref Sequence ENSEMBL: ENSMUSP00000154869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090300] [ENSMUST00000229614]
Predicted Effect probably benign
Transcript: ENSMUST00000090300
AA Change: I288V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087770
Gene: ENSMUSG00000060657
AA Change: I288V

low complexity region 116 127 N/A INTRINSIC
low complexity region 290 305 N/A INTRINSIC
Pfam:NYN 351 492 1.5e-21 PFAM
RRM 511 579 3.17e-1 SMART
low complexity region 599 610 N/A INTRINSIC
RRM 790 864 4.47e-3 SMART
internal_repeat_2 871 914 1.57e-5 PROSPERO
low complexity region 944 960 N/A INTRINSIC
Pfam:OST-HTH 1096 1167 1e-11 PFAM
low complexity region 1181 1186 N/A INTRINSIC
Pfam:OST-HTH 1256 1328 1.2e-10 PFAM
Pfam:OST-HTH 1332 1404 2.4e-10 PFAM
Pfam:OST-HTH 1408 1480 6.8e-13 PFAM
Pfam:OST-HTH 1483 1555 3e-14 PFAM
low complexity region 1682 1701 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229614
AA Change: I109V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 92.6%
  • 20x: 76.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative peroxisomal protein that appears to be conserved across Euteleostomi. In humans, it may be autoantigenic. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit female infertility with abnormalities in oogenic processes including meiotic progression, genomic integrity and acquisition of developmental competence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aar2 T G 2: 156,550,973 V94G probably benign Het
Acp5 A T 9: 22,129,922 S70T possibly damaging Het
Adcy1 C G 11: 7,139,162 N525K possibly damaging Het
AI464131 A T 4: 41,498,912 N239K probably benign Het
Aknad1 A G 3: 108,781,239 M628V probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Cacna1d A G 14: 30,123,496 V572A probably benign Het
Ccdc158 A C 5: 92,662,118 M177R probably benign Het
Ccdc191 A T 16: 43,947,496 R678* probably null Het
Cdkn2d C A 9: 21,290,992 probably benign Het
Cdx2 G T 5: 147,303,287 T193K probably damaging Het
Cfap44 T A 16: 44,422,318 M695K probably benign Het
Cfap70 A C 14: 20,448,605 S5A probably benign Het
Chd9 T C 8: 90,932,828 S139P probably damaging Het
Chmp7 A G 14: 69,720,997 V241A probably damaging Het
Cnga1 A G 5: 72,605,031 I380T probably damaging Het
Cts6 T A 13: 61,201,819 E53D probably damaging Het
Dclk3 A T 9: 111,482,628 N646I probably damaging Het
Dnhd1 A G 7: 105,721,531 S4673G probably benign Het
Dock4 G T 12: 40,737,540 S818I probably damaging Het
Dysf C T 6: 84,064,479 Q156* probably null Het
Fam163b T C 2: 27,112,634 N117S probably damaging Het
Fam89a A G 8: 124,741,232 Y114H probably damaging Het
Flcn T C 11: 59,801,076 N249S probably benign Het
Gm20422 T C 8: 69,766,715 Y53C probably damaging Het
Gnai1 A G 5: 18,273,550 S206P probably damaging Het
Hal T C 10: 93,503,482 S478P possibly damaging Het
Haus3 G A 5: 34,166,256 P337S possibly damaging Het
Hectd1 T A 12: 51,769,318 M1324L possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Hspa9 A T 18: 34,946,646 Y243* probably null Het
Htr3a T C 9: 48,906,386 T96A probably benign Het
Ift140 C A 17: 25,045,523 C557* probably null Het
Jph3 A G 8: 121,753,720 Q379R possibly damaging Het
Kcnb1 A G 2: 167,104,969 V653A probably benign Het
Kif14 A G 1: 136,527,393 E1551G probably damaging Het
Krt17 G A 11: 100,260,878 R30* probably null Het
Lamb3 A T 1: 193,321,053 D100V probably damaging Het
Map2 A G 1: 66,416,106 D1385G probably damaging Het
Map3k21 A G 8: 125,944,970 D999G possibly damaging Het
Mcam T G 9: 44,140,205 probably null Het
Med18 T C 4: 132,460,026 H99R probably damaging Het
Mettl25 C T 10: 105,826,525 V195I probably damaging Het
Myh8 A G 11: 67,301,692 T1466A probably benign Het
Myo1e A T 9: 70,342,126 I503F possibly damaging Het
Myo3b T A 2: 70,105,425 C61S probably benign Het
Nf1 A T 11: 79,418,574 K438M possibly damaging Het
Nlrp9c A G 7: 26,378,012 S727P possibly damaging Het
Nmbr C T 10: 14,770,395 Q338* probably null Het
Nt5e A G 9: 88,367,332 S440G possibly damaging Het
Nubp2 T C 17: 24,884,471 E144G probably damaging Het
Olfr1126 T C 2: 87,458,037 F291L probably benign Het
Olfr593 G A 7: 103,212,726 V289M possibly damaging Het
Olfr694 A G 7: 106,689,255 Y159H probably benign Het
Otogl T A 10: 107,806,696 N1291I probably damaging Het
Pa2g4 T C 10: 128,563,642 K51R probably benign Het
Pcdhb12 A G 18: 37,436,727 I309V probably benign Het
Pck1 T G 2: 173,157,068 I373S possibly damaging Het
Pga5 A G 19: 10,669,453 Y305H probably damaging Het
Plxnd1 G T 6: 115,968,793 D906E probably benign Het
Ppfia4 T C 1: 134,329,189 E98G possibly damaging Het
Rab39 G A 9: 53,706,030 T29I probably damaging Het
Raet1e C A 10: 22,180,862 H112Q possibly damaging Het
Rars2 T C 4: 34,645,838 Y252H probably damaging Het
Rars2 A C 4: 34,656,030 Q421P probably benign Het
Rasa2 A T 9: 96,568,407 D479E probably damaging Het
Rbl2 A T 8: 91,106,507 T689S probably damaging Het
Rims4 C T 2: 163,864,025 V230M probably benign Het
Skp2 A C 15: 9,127,884 probably null Het
Slc35f4 A T 14: 49,304,256 I347N possibly damaging Het
Slc4a2 A T 5: 24,436,274 probably null Het
Slc52a3 T C 2: 152,008,156 *461Q probably null Het
Slc6a1 G A 6: 114,302,800 V142I probably benign Het
Susd5 A G 9: 114,096,909 *620W probably null Het
Timm21 T C 18: 84,947,666 N239S probably damaging Het
Tmem63c T C 12: 87,075,639 W404R probably damaging Het
Tnrc6b A G 15: 80,887,864 D1118G probably damaging Het
Traf2 G C 2: 25,537,126 A71G possibly damaging Het
Trim54 A G 5: 31,134,119 M195V probably benign Het
Trip11 C T 12: 101,884,728 E741K probably damaging Het
Trp73 AGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTG 4: 154,062,524 probably benign Het
Trpm5 G T 7: 143,082,958 T414N probably damaging Het
Vps51 G T 19: 6,071,437 S185* probably null Het
Zfp329 G T 7: 12,810,829 T256K probably damaging Het
Zfp729b A G 13: 67,591,903 Y748H probably damaging Het
Zfp777 T C 6: 48,024,969 E773G probably damaging Het
Other mutations in Marf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Marf1 APN 16 14115742 missense possibly damaging 0.49
IGL00933:Marf1 APN 16 14117357 missense probably damaging 1.00
IGL01101:Marf1 APN 16 14146736 missense possibly damaging 0.85
IGL02140:Marf1 APN 16 14141912 missense probably damaging 0.99
IGL03196:Marf1 APN 16 14140259 missense possibly damaging 0.64
PIT4283001:Marf1 UTSW 16 14128568 missense probably benign 0.22
R0016:Marf1 UTSW 16 14152265 missense probably damaging 0.99
R0016:Marf1 UTSW 16 14152265 missense probably damaging 0.99
R0046:Marf1 UTSW 16 14111727 missense possibly damaging 0.83
R0046:Marf1 UTSW 16 14111727 missense possibly damaging 0.83
R0056:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0057:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0058:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0058:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0113:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0115:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0179:Marf1 UTSW 16 14151176 missense probably damaging 1.00
R0238:Marf1 UTSW 16 14151283 missense probably benign 0.00
R0294:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0295:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0316:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0318:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0375:Marf1 UTSW 16 14151320 splice site probably benign
R0383:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0391:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0504:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0589:Marf1 UTSW 16 14142055 splice site probably benign
R0603:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0610:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R1240:Marf1 UTSW 16 14146762 missense possibly damaging 0.48
R1445:Marf1 UTSW 16 14115824 missense probably benign
R1716:Marf1 UTSW 16 14142586 missense possibly damaging 0.95
R1921:Marf1 UTSW 16 14128601 missense possibly damaging 0.63
R2098:Marf1 UTSW 16 14114200 missense probably benign 0.00
R2155:Marf1 UTSW 16 14132429 missense probably damaging 0.99
R2177:Marf1 UTSW 16 14152607 missense probably benign 0.01
R2195:Marf1 UTSW 16 14111699 missense probably benign
R2410:Marf1 UTSW 16 14115827 missense probably benign 0.02
R2999:Marf1 UTSW 16 14142641 missense possibly damaging 0.60
R3000:Marf1 UTSW 16 14142641 missense possibly damaging 0.60
R3147:Marf1 UTSW 16 14125979 missense possibly damaging 0.64
R3148:Marf1 UTSW 16 14125979 missense possibly damaging 0.64
R3430:Marf1 UTSW 16 14140177 unclassified probably benign
R3821:Marf1 UTSW 16 14142554 missense probably damaging 1.00
R4383:Marf1 UTSW 16 14142641 missense possibly damaging 0.60
R4384:Marf1 UTSW 16 14142641 missense possibly damaging 0.60
R4520:Marf1 UTSW 16 14132666 missense probably damaging 0.98
R4554:Marf1 UTSW 16 14153977 start gained probably benign
R4557:Marf1 UTSW 16 14153977 start gained probably benign
R4768:Marf1 UTSW 16 14131597 missense possibly damaging 0.93
R4784:Marf1 UTSW 16 14152457 missense probably benign
R4857:Marf1 UTSW 16 14128611 nonsense probably null
R4863:Marf1 UTSW 16 14132665 missense possibly damaging 0.60
R4994:Marf1 UTSW 16 14114231 missense probably benign
R5191:Marf1 UTSW 16 14146078 missense probably damaging 1.00
R5503:Marf1 UTSW 16 14152231 missense probably damaging 0.99
R5813:Marf1 UTSW 16 14152585 missense probably benign 0.35
R5905:Marf1 UTSW 16 14127249 missense probably damaging 0.99
R5960:Marf1 UTSW 16 14152417 missense probably damaging 0.98
R6104:Marf1 UTSW 16 14117455 missense probably damaging 0.99
R6387:Marf1 UTSW 16 14141640 makesense probably null
R6533:Marf1 UTSW 16 14115799 missense probably benign 0.16
R6608:Marf1 UTSW 16 14132714 missense probably damaging 1.00
R6642:Marf1 UTSW 16 14132747 missense probably benign 0.02
R6954:Marf1 UTSW 16 14138520 missense probably damaging 1.00
R6994:Marf1 UTSW 16 14128857 missense probably damaging 1.00
R7010:Marf1 UTSW 16 14137001 missense probably damaging 0.99
R7090:Marf1 UTSW 16 14111702 missense possibly damaging 0.52
R7174:Marf1 UTSW 16 14136953 missense probably damaging 1.00
R7221:Marf1 UTSW 16 14142485 missense probably damaging 1.00
R7247:Marf1 UTSW 16 14127093 missense probably damaging 1.00
R7557:Marf1 UTSW 16 14132696 missense probably damaging 1.00
R7798:Marf1 UTSW 16 14138451 missense probably benign 0.00
R7807:Marf1 UTSW 16 14153889 nonsense probably null
R7855:Marf1 UTSW 16 14114201 missense probably benign 0.27
R7867:Marf1 UTSW 16 14128606 missense probably damaging 0.97
R7893:Marf1 UTSW 16 14146735 missense probably damaging 1.00
R7938:Marf1 UTSW 16 14114201 missense probably benign 0.27
R7950:Marf1 UTSW 16 14128606 missense probably damaging 0.97
R7976:Marf1 UTSW 16 14146735 missense probably damaging 1.00
U24488:Marf1 UTSW 16 14132366 nonsense probably null
X0025:Marf1 UTSW 16 14114278 missense probably damaging 1.00
Z1176:Marf1 UTSW 16 14115777 missense probably benign 0.00
Predicted Primers
Posted On2013-08-19