Incidental Mutation 'R8677:Acd'
ID661452
Institutional Source Beutler Lab
Gene Symbol Acd
Ensembl Gene ENSMUSG00000038000
Gene Nameadrenocortical dysplasia
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.450) question?
Stock #R8677 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location105695860-105701102 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 105700944 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 25 (S25R)
Ref Sequence ENSEMBL: ENSMUSP00000048180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013299] [ENSMUST00000042608] [ENSMUST00000093195] [ENSMUST00000098444] [ENSMUST00000211870] [ENSMUST00000211888] [ENSMUST00000212061] [ENSMUST00000212352] [ENSMUST00000212430] [ENSMUST00000212642] [ENSMUST00000212650] [ENSMUST00000213019]
Predicted Effect probably benign
Transcript: ENSMUST00000013299
SMART Domains Protein: ENSMUSP00000013299
Gene: ENSMUSG00000013155

DomainStartEndE-ValueType
low complexity region 220 236 N/A INTRINSIC
Pfam:Enkurin 243 339 6.3e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000042608
AA Change: S25R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048180
Gene: ENSMUSG00000038000
AA Change: S25R

DomainStartEndE-ValueType
Pfam:TPP1 11 118 2.4e-23 PFAM
low complexity region 259 272 N/A INTRINSIC
low complexity region 296 319 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093195
SMART Domains Protein: ENSMUSP00000090886
Gene: ENSMUSG00000005699

DomainStartEndE-ValueType
PB1 15 95 2.81e-15 SMART
PDZ 167 250 1.38e-12 SMART
low complexity region 263 286 N/A INTRINSIC
low complexity region 309 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098444
SMART Domains Protein: ENSMUSP00000096043
Gene: ENSMUSG00000005699

DomainStartEndE-ValueType
PB1 4 79 1.28e-9 SMART
PDZ 151 234 1.38e-12 SMART
low complexity region 247 270 N/A INTRINSIC
low complexity region 293 307 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211870
AA Change: S25R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000211888
Predicted Effect probably benign
Transcript: ENSMUST00000212061
Predicted Effect probably benign
Transcript: ENSMUST00000212352
Predicted Effect probably benign
Transcript: ENSMUST00000212430
Predicted Effect probably damaging
Transcript: ENSMUST00000212642
AA Change: S25R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000212650
AA Change: S25R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000213019
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in telomere function. This protein is one of six core proteins in the telosome/shelterin telomeric complex, which functions to maintain telomere length and to protect telomere ends. Through its interaction with other components, this protein plays a key role in the assembly and stabilization of this complex, and it mediates the access of telomerase to the telomere. Multiple transcript variants encoding different isoforms have been found for this gene. This gene, which is also referred to as TPP1, is distinct from the unrelated TPP1 gene on chromosome 11, which encodes tripeptidyl-peptidase I. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene produce skeletal, coat, vibrissae and skin pigmentation defects. Kidney and adrenal abnormalities cause a shortened lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,595,471 D474G probably benign Het
1190007I07Rik G T 10: 82,620,216 T37K possibly damaging Het
2610507B11Rik C T 11: 78,284,156 R1706C probably damaging Het
Acly A T 11: 100,519,743 H136Q probably damaging Het
Adrm1 C T 2: 180,172,039 T2M probably benign Het
Ankrd12 A T 17: 66,024,214 L246M probably damaging Het
Cacnb3 T C 15: 98,642,050 L258P probably damaging Het
Ccdc129 A G 6: 55,872,594 H37R probably benign Het
Cd36 C T 5: 17,820,495 V76M probably damaging Het
Cep120 A G 18: 53,738,561 F80L possibly damaging Het
Clcn1 A T 6: 42,290,585 probably null Het
Col17a1 T C 19: 47,651,801 T1042A probably benign Het
Comp A T 8: 70,380,260 N623Y probably damaging Het
Ctnnal1 A G 4: 56,813,272 L653P probably benign Het
Cx3cl1 G T 8: 94,779,815 R149S probably benign Het
Dbndd2 T A 2: 164,488,602 N58K probably damaging Het
Dclk1 A G 3: 55,502,419 I595V probably damaging Het
Dhx15 T C 5: 52,184,544 D144G probably benign Het
Dlat T C 9: 50,658,707 E120G probably damaging Het
Fam171a1 T A 2: 3,220,315 Y273N probably damaging Het
Fndc3b A T 3: 27,457,027 V778D probably benign Het
Grn T C 11: 102,433,567 S129P possibly damaging Het
Grxcr1 T C 5: 68,110,414 F169L possibly damaging Het
Hcn2 A G 10: 79,724,785 I317V probably benign Het
Heca T C 10: 17,915,676 N211D probably benign Het
Htr1f T C 16: 64,926,051 T293A possibly damaging Het
Ifitm10 T A 7: 142,356,012 I116F probably benign Het
Ivl A T 3: 92,572,679 D26E probably benign Het
Kcnma1 T A 14: 23,386,350 E761V probably benign Het
Ltbp1 G T 17: 75,348,758 V923F probably benign Het
Mfsd4b2 A T 10: 39,923,809 F32L probably benign Het
Micu2 T C 14: 57,923,963 R301G possibly damaging Het
Miip C T 4: 147,863,046 C219Y probably damaging Het
Mn1 T A 5: 111,419,019 L285* probably null Het
Mthfd1l T A 10: 4,048,250 N664K possibly damaging Het
Mttp A T 3: 138,104,676 H659Q probably benign Het
Myadml2 G A 11: 120,647,989 P7S probably benign Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Nlrp4c C T 7: 6,072,645 T645I probably damaging Het
Notch1 C T 2: 26,469,924 V1260I probably damaging Het
Numa1 T C 7: 102,000,941 L1293P probably damaging Het
Olfr403 A T 11: 74,195,589 I29F probably benign Het
Olfr684 A G 7: 105,157,568 L38P probably benign Het
Pcdh12 G T 18: 38,282,138 H645N probably benign Het
Pdcd1 A T 1: 94,041,227 L122H probably damaging Het
Pknox2 G A 9: 36,910,591 P246L probably damaging Het
Polr2a A T 11: 69,735,555 S1590T possibly damaging Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
Proser1 A G 3: 53,477,701 T335A probably benign Het
Ptprc A G 1: 138,083,597 I598T probably damaging Het
Rasal3 T C 17: 32,396,854 T337A probably benign Het
Rasgrp3 A T 17: 75,512,060 T415S probably benign Het
Rbm7 T A 9: 48,489,973 R152* probably null Het
Sf3b2 C T 19: 5,286,229 R513H probably damaging Het
Slc22a30 A G 19: 8,386,671 S214P probably benign Het
Spam1 A G 6: 24,796,985 T312A probably benign Het
Ssh2 A G 11: 77,455,193 T1335A possibly damaging Het
Tef T A 15: 81,814,968 L59Q probably damaging Het
Tmem131l A C 3: 83,928,702 V700G probably damaging Het
Twsg1 A G 17: 65,926,407 S183P probably damaging Het
Unc13c T C 9: 73,932,961 T203A probably benign Het
Vmn2r75 G T 7: 86,165,202 P361Q possibly damaging Het
Xirp2 A T 2: 67,516,634 N3073I probably damaging Het
Zfp114 A G 7: 24,180,645 N140D probably benign Het
Other mutations in Acd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Acd APN 8 105698454 missense probably damaging 1.00
IGL02322:Acd APN 8 105698636 missense probably benign 0.04
R0613:Acd UTSW 8 105700568 splice site probably null
R1750:Acd UTSW 8 105698892 missense possibly damaging 0.93
R1824:Acd UTSW 8 105700490 missense probably damaging 1.00
R1870:Acd UTSW 8 105698407 critical splice donor site probably null
R2888:Acd UTSW 8 105698838 missense probably benign 0.08
R2945:Acd UTSW 8 105700295 nonsense probably null
R3001:Acd UTSW 8 105700281 critical splice donor site probably null
R3002:Acd UTSW 8 105700281 critical splice donor site probably null
R3003:Acd UTSW 8 105700281 critical splice donor site probably null
R4795:Acd UTSW 8 105701015 missense possibly damaging 0.92
R4806:Acd UTSW 8 105698290 missense possibly damaging 0.75
R6111:Acd UTSW 8 105698287 missense probably benign 0.04
R6236:Acd UTSW 8 105700495 missense probably benign 0.01
R7096:Acd UTSW 8 105698489 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- TCTTACCAGTCGGAGGTGTC -3'
(R):5'- AGTCTCAAACTTAGGATCCGC -3'

Sequencing Primer
(F):5'- TGGGTTCCGTCTGACACAAGTAAC -3'
(R):5'- GGAAGACCCTTTCCTGG -3'
Posted On2021-03-08