Incidental Mutation 'R8677:0610010F05Rik'
List |< first << previous [record 53 of 539672] next >> last >|
ID661462
Institutional Source Beutler Lab
Gene Symbol 0610010F05Rik
Ensembl Gene ENSMUSG00000042208
Gene NameRIKEN cDNA 0610010F05 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R8677 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location23564961-23633639 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23595471 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 474 (D474G)
Ref Sequence ENSEMBL: ENSMUSP00000136118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043356] [ENSMUST00000093267] [ENSMUST00000109532] [ENSMUST00000123909] [ENSMUST00000155903] [ENSMUST00000180260]
Predicted Effect probably benign
Transcript: ENSMUST00000043356
AA Change: D474G

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000044265
Gene: ENSMUSG00000042208
AA Change: D474G

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 5.1e-107 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093267
AA Change: D328G

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000090955
Gene: ENSMUSG00000042208
AA Change: D328G

DomainStartEndE-ValueType
Pfam:DUF3342 1 303 7.7e-107 PFAM
low complexity region 419 430 N/A INTRINSIC
low complexity region 433 450 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109532
AA Change: D474G

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105158
Gene: ENSMUSG00000042208
AA Change: D474G

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 5.1e-107 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123909
SMART Domains Protein: ENSMUSP00000117103
Gene: ENSMUSG00000042208

DomainStartEndE-ValueType
low complexity region 71 82 N/A INTRINSIC
low complexity region 85 102 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000155903
AA Change: D474G

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000137799
Gene: ENSMUSG00000042208
AA Change: D474G

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 1e-106 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180260
AA Change: D474G

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000136118
Gene: ENSMUSG00000042208
AA Change: D474G

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 4.5e-107 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190007I07Rik G T 10: 82,620,216 T37K possibly damaging Het
2610507B11Rik C T 11: 78,284,156 R1706C probably damaging Het
Acd A C 8: 105,700,944 S25R probably damaging Het
Acly A T 11: 100,519,743 H136Q probably damaging Het
Adrm1 C T 2: 180,172,039 T2M probably benign Het
Ankrd12 A T 17: 66,024,214 L246M probably damaging Het
Cacnb3 T C 15: 98,642,050 L258P probably damaging Het
Ccdc129 A G 6: 55,872,594 H37R probably benign Het
Cd36 C T 5: 17,820,495 V76M probably damaging Het
Cep120 A G 18: 53,738,561 F80L possibly damaging Het
Clcn1 A T 6: 42,290,585 probably null Het
Col17a1 T C 19: 47,651,801 T1042A probably benign Het
Comp A T 8: 70,380,260 N623Y probably damaging Het
Ctnnal1 A G 4: 56,813,272 L653P probably benign Het
Cx3cl1 G T 8: 94,779,815 R149S probably benign Het
Dbndd2 T A 2: 164,488,602 N58K probably damaging Het
Dclk1 A G 3: 55,502,419 I595V probably damaging Het
Dhx15 T C 5: 52,184,544 D144G probably benign Het
Dlat T C 9: 50,658,707 E120G probably damaging Het
Fam171a1 T A 2: 3,220,315 Y273N probably damaging Het
Fndc3b A T 3: 27,457,027 V778D probably benign Het
Grn T C 11: 102,433,567 S129P possibly damaging Het
Grxcr1 T C 5: 68,110,414 F169L possibly damaging Het
Hcn2 A G 10: 79,724,785 I317V probably benign Het
Heca T C 10: 17,915,676 N211D probably benign Het
Htr1f T C 16: 64,926,051 T293A possibly damaging Het
Ifitm10 T A 7: 142,356,012 I116F probably benign Het
Ivl A T 3: 92,572,679 D26E probably benign Het
Kcnma1 T A 14: 23,386,350 E761V probably benign Het
Ltbp1 G T 17: 75,348,758 V923F probably benign Het
Mfsd4b2 A T 10: 39,923,809 F32L probably benign Het
Micu2 T C 14: 57,923,963 R301G possibly damaging Het
Miip C T 4: 147,863,046 C219Y probably damaging Het
Mn1 T A 5: 111,419,019 L285* probably null Het
Mthfd1l T A 10: 4,048,250 N664K possibly damaging Het
Mttp A T 3: 138,104,676 H659Q probably benign Het
Myadml2 G A 11: 120,647,989 P7S probably benign Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Nlrp4c C T 7: 6,072,645 T645I probably damaging Het
Notch1 C T 2: 26,469,924 V1260I probably damaging Het
Numa1 T C 7: 102,000,941 L1293P probably damaging Het
Olfr403 A T 11: 74,195,589 I29F probably benign Het
Olfr684 A G 7: 105,157,568 L38P probably benign Het
Pcdh12 G T 18: 38,282,138 H645N probably benign Het
Pdcd1 A T 1: 94,041,227 L122H probably damaging Het
Pknox2 G A 9: 36,910,591 P246L probably damaging Het
Polr2a A T 11: 69,735,555 S1590T possibly damaging Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
Proser1 A G 3: 53,477,701 T335A probably benign Het
Ptprc A G 1: 138,083,597 I598T probably damaging Het
Rasal3 T C 17: 32,396,854 T337A probably benign Het
Rasgrp3 A T 17: 75,512,060 T415S probably benign Het
Rbm7 T A 9: 48,489,973 R152* probably null Het
Sf3b2 C T 19: 5,286,229 R513H probably damaging Het
Slc22a30 A G 19: 8,386,671 S214P probably benign Het
Spam1 A G 6: 24,796,985 T312A probably benign Het
Ssh2 A G 11: 77,455,193 T1335A possibly damaging Het
Tef T A 15: 81,814,968 L59Q probably damaging Het
Tmem131l A C 3: 83,928,702 V700G probably damaging Het
Twsg1 A G 17: 65,926,407 S183P probably damaging Het
Unc13c T C 9: 73,932,961 T203A probably benign Het
Vmn2r75 G T 7: 86,165,202 P361Q possibly damaging Het
Xirp2 A T 2: 67,516,634 N3073I probably damaging Het
Zfp114 A G 7: 24,180,645 N140D probably benign Het
Other mutations in 0610010F05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:0610010F05Rik APN 11 23595434 missense probably damaging 1.00
IGL01444:0610010F05Rik APN 11 23620225 splice site probably benign
IGL01522:0610010F05Rik APN 11 23582865 critical splice donor site probably null
IGL01819:0610010F05Rik APN 11 23584561 missense probably benign 0.29
IGL02470:0610010F05Rik APN 11 23615222 missense probably damaging 0.99
IGL03046:0610010F05Rik UTSW 11 23615150 missense possibly damaging 0.77
R0139:0610010F05Rik UTSW 11 23620214 splice site probably benign
R0334:0610010F05Rik UTSW 11 23617129 splice site probably benign
R0646:0610010F05Rik UTSW 11 23575491 missense probably damaging 0.99
R1078:0610010F05Rik UTSW 11 23611762 missense probably benign 0.45
R1263:0610010F05Rik UTSW 11 23620278 nonsense probably null
R1471:0610010F05Rik UTSW 11 23615222 missense probably damaging 0.99
R1568:0610010F05Rik UTSW 11 23589971 missense probably damaging 1.00
R2163:0610010F05Rik UTSW 11 23576826 splice site probably benign
R2318:0610010F05Rik UTSW 11 23588701 missense probably damaging 1.00
R2426:0610010F05Rik UTSW 11 23576801 missense probably damaging 1.00
R4373:0610010F05Rik UTSW 11 23615265 splice site probably null
R4688:0610010F05Rik UTSW 11 23593449 missense probably benign
R4816:0610010F05Rik UTSW 11 23615243 missense possibly damaging 0.67
R5046:0610010F05Rik UTSW 11 23620354 missense probably benign 0.23
R5156:0610010F05Rik UTSW 11 23593424 critical splice donor site probably null
R5249:0610010F05Rik UTSW 11 23575483 makesense probably null
R5615:0610010F05Rik UTSW 11 23606759 missense probably damaging 0.96
R6758:0610010F05Rik UTSW 11 23588475 splice site probably null
R6860:0610010F05Rik UTSW 11 23625100 missense probably damaging 1.00
R6910:0610010F05Rik UTSW 11 23620447 missense probably damaging 0.99
R7255:0610010F05Rik UTSW 11 23620465 missense probably benign 0.41
R7286:0610010F05Rik UTSW 11 23622479 missense probably benign 0.07
R7603:0610010F05Rik UTSW 11 23566191 missense probably benign
R7618:0610010F05Rik UTSW 11 23584550 missense possibly damaging 0.91
R7717:0610010F05Rik UTSW 11 23606757 missense probably benign 0.05
R8110:0610010F05Rik UTSW 11 23576764 missense probably benign
X0026:0610010F05Rik UTSW 11 23576767 missense probably benign 0.00
X0067:0610010F05Rik UTSW 11 23593420 splice site probably null
Z1177:0610010F05Rik UTSW 11 23624960 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- CAGTCCAGCTCTGAAATTGTAAC -3'
(R):5'- TACTATTCCCTGAGCTTTGGTG -3'

Sequencing Primer
(F):5'- TTGTAACTATCTGAGGACTGCC -3'
(R):5'- ATTCCCTGAGCTTTGGTGTGTATATG -3'
Posted On2021-03-08