Incidental Mutation 'R8677:Olfr403'
ID661464
Institutional Source Beutler Lab
Gene Symbol Olfr403
Ensembl Gene ENSMUSG00000070378
Gene Nameolfactory receptor 403
SynonymsMOR125-5_p, IA7, GA_x6K02T2P1NL-4348188-4349129
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R8677 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location74186249-74198612 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74195589 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 29 (I29F)
Ref Sequence ENSEMBL: ENSMUSP00000145741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076675] [ENSMUST00000206114]
AlphaFold Q7TRX2
Predicted Effect probably benign
Transcript: ENSMUST00000076675
AA Change: I29F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000075971
Gene: ENSMUSG00000070378
AA Change: I29F

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 7.3e-59 PFAM
Pfam:7tm_1 41 238 7.2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206114
AA Change: I29F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,595,471 D474G probably benign Het
1190007I07Rik G T 10: 82,620,216 T37K possibly damaging Het
2610507B11Rik C T 11: 78,284,156 R1706C probably damaging Het
Acd A C 8: 105,700,944 S25R probably damaging Het
Acly A T 11: 100,519,743 H136Q probably damaging Het
Adrm1 C T 2: 180,172,039 T2M probably benign Het
Ankrd12 A T 17: 66,024,214 L246M probably damaging Het
Cacnb3 T C 15: 98,642,050 L258P probably damaging Het
Ccdc129 A G 6: 55,872,594 H37R probably benign Het
Cd36 C T 5: 17,820,495 V76M probably damaging Het
Cep120 A G 18: 53,738,561 F80L possibly damaging Het
Clcn1 A T 6: 42,290,585 probably null Het
Col17a1 T C 19: 47,651,801 T1042A probably benign Het
Comp A T 8: 70,380,260 N623Y probably damaging Het
Ctnnal1 A G 4: 56,813,272 L653P probably benign Het
Cx3cl1 G T 8: 94,779,815 R149S probably benign Het
Dbndd2 T A 2: 164,488,602 N58K probably damaging Het
Dclk1 A G 3: 55,502,419 I595V probably damaging Het
Dhx15 T C 5: 52,184,544 D144G probably benign Het
Dlat T C 9: 50,658,707 E120G probably damaging Het
Fam171a1 T A 2: 3,220,315 Y273N probably damaging Het
Fndc3b A T 3: 27,457,027 V778D probably benign Het
Grn T C 11: 102,433,567 S129P possibly damaging Het
Grxcr1 T C 5: 68,110,414 F169L possibly damaging Het
Hcn2 A G 10: 79,724,785 I317V probably benign Het
Heca T C 10: 17,915,676 N211D probably benign Het
Htr1f T C 16: 64,926,051 T293A possibly damaging Het
Ifitm10 T A 7: 142,356,012 I116F probably benign Het
Ivl A T 3: 92,572,679 D26E probably benign Het
Kcnma1 T A 14: 23,386,350 E761V probably benign Het
Ltbp1 G T 17: 75,348,758 V923F probably benign Het
Mfsd4b2 A T 10: 39,923,809 F32L probably benign Het
Micu2 T C 14: 57,923,963 R301G possibly damaging Het
Miip C T 4: 147,863,046 C219Y probably damaging Het
Mn1 T A 5: 111,419,019 L285* probably null Het
Mthfd1l T A 10: 4,048,250 N664K possibly damaging Het
Mttp A T 3: 138,104,676 H659Q probably benign Het
Myadml2 G A 11: 120,647,989 P7S probably benign Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Nlrp4c C T 7: 6,072,645 T645I probably damaging Het
Notch1 C T 2: 26,469,924 V1260I probably damaging Het
Numa1 T C 7: 102,000,941 L1293P probably damaging Het
Olfr684 A G 7: 105,157,568 L38P probably benign Het
Pcdh12 G T 18: 38,282,138 H645N probably benign Het
Pdcd1 A T 1: 94,041,227 L122H probably damaging Het
Pknox2 G A 9: 36,910,591 P246L probably damaging Het
Polr2a A T 11: 69,735,555 S1590T possibly damaging Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
Proser1 A G 3: 53,477,701 T335A probably benign Het
Ptprc A G 1: 138,083,597 I598T probably damaging Het
Rasal3 T C 17: 32,396,854 T337A probably benign Het
Rasgrp3 A T 17: 75,512,060 T415S probably benign Het
Rbm7 T A 9: 48,489,973 R152* probably null Het
Sf3b2 C T 19: 5,286,229 R513H probably damaging Het
Slc22a30 A G 19: 8,386,671 S214P probably benign Het
Spam1 A G 6: 24,796,985 T312A probably benign Het
Ssh2 A G 11: 77,455,193 T1335A possibly damaging Het
Tef T A 15: 81,814,968 L59Q probably damaging Het
Tmem131l A C 3: 83,928,702 V700G probably damaging Het
Twsg1 A G 17: 65,926,407 S183P probably damaging Het
Unc13c T C 9: 73,932,961 T203A probably benign Het
Vmn2r75 G T 7: 86,165,202 P361Q possibly damaging Het
Xirp2 A T 2: 67,516,634 N3073I probably damaging Het
Zfp114 A G 7: 24,180,645 N140D probably benign Het
Other mutations in Olfr403
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Olfr403 APN 11 74195761 missense probably damaging 1.00
IGL01716:Olfr403 APN 11 74196381 missense probably benign 0.01
R0598:Olfr403 UTSW 11 74195832 missense possibly damaging 0.90
R1168:Olfr403 UTSW 11 74196421 missense probably benign
R1440:Olfr403 UTSW 11 74195679 missense probably damaging 1.00
R1657:Olfr403 UTSW 11 74195896 missense probably damaging 0.98
R1834:Olfr403 UTSW 11 74195653 missense probably benign 0.00
R1990:Olfr403 UTSW 11 74196163 missense probably damaging 0.99
R1991:Olfr403 UTSW 11 74196163 missense probably damaging 0.99
R2206:Olfr403 UTSW 11 74196324 missense possibly damaging 0.87
R2207:Olfr403 UTSW 11 74196324 missense possibly damaging 0.87
R3103:Olfr403 UTSW 11 74196075 missense probably benign 0.39
R4662:Olfr403 UTSW 11 74195716 missense probably damaging 1.00
R4844:Olfr403 UTSW 11 74196076 missense probably damaging 0.98
R5336:Olfr403 UTSW 11 74196033 missense probably damaging 1.00
R5918:Olfr403 UTSW 11 74196118 missense probably damaging 0.96
R6858:Olfr403 UTSW 11 74196099 missense probably benign 0.01
R7175:Olfr403 UTSW 11 74196178 nonsense probably null
R7362:Olfr403 UTSW 11 74195586 missense probably benign 0.01
R7670:Olfr403 UTSW 11 74196207 missense probably damaging 1.00
R8957:Olfr403 UTSW 11 74195946 missense probably damaging 1.00
R9029:Olfr403 UTSW 11 74195737 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GGTGTACATAGAGCTGATCCC -3'
(R):5'- ACATCTGTGCCATACATCCC -3'

Sequencing Primer
(F):5'- GAGCTGATCCCTTGAGTAAACTG -3'
(R):5'- AGGAGATGGCCTTGCTACCTAG -3'
Posted On2021-03-08