Incidental Mutation 'R8677:Grn'
ID661468
Institutional Source Beutler Lab
Gene Symbol Grn
Ensembl Gene ENSMUSG00000034708
Gene Namegranulin
Synonymsprogranulin, epithelin, acrogranulin, PC cell-derived growth factor, Pgrn
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.302) question?
Stock #R8677 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location102430315-102437048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102433567 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 129 (S129P)
Ref Sequence ENSEMBL: ENSMUSP00000046340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049057] [ENSMUST00000049460] [ENSMUST00000125819] [ENSMUST00000129997]
Predicted Effect probably benign
Transcript: ENSMUST00000049057
SMART Domains Protein: ENSMUSP00000038486
Gene: ENSMUSG00000034685

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UPF0560 41 820 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000049460
AA Change: S129P

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000046340
Gene: ENSMUSG00000034708
AA Change: S129P

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
GRAN 74 125 1.32e-22 SMART
GRAN 138 190 7.38e-26 SMART
GRAN 220 272 5.76e-28 SMART
GRAN 295 346 1.19e-29 SMART
GRAN 377 427 1.84e-26 SMART
GRAN 455 506 7.1e-28 SMART
GRAN 530 581 1.48e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125819
SMART Domains Protein: ENSMUSP00000134948
Gene: ENSMUSG00000034708

DomainStartEndE-ValueType
GRAN 42 72 5.03e-4 SMART
GRAN 100 151 7.1e-28 SMART
GRAN 175 226 1.48e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000129997
AA Change: S116P

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135739
Gene: ENSMUSG00000034708
AA Change: S116P

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
GRAN 61 112 1.32e-22 SMART
GRAN 125 177 7.38e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177428
SMART Domains Protein: ENSMUSP00000134893
Gene: ENSMUSG00000034708

DomainStartEndE-ValueType
GRAN 1 49 8.68e-23 SMART
GRAN 77 128 7.1e-28 SMART
GRAN 152 180 3.98e-2 SMART
low complexity region 244 259 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Granulins are a family of secreted, glycosylated peptides that are cleaved from a single precursor protein with 7.5 repeats of a highly conserved 12-cysteine granulin/epithelin motif. The 88 kDa precursor protein, progranulin, is also called proepithelin and PC cell-derived growth factor. Cleavage of the signal peptide produces mature granulin which can be further cleaved into a variety of active, 6 kDa peptides. These smaller cleavage products are named granulin A, granulin B, granulin C, etc. Epithelins 1 and 2 are synonymous with granulins A and B, respectively. Both the peptides and intact granulin protein regulate cell growth. However, different members of the granulin protein family may act as inhibitors, stimulators, or have dual actions on cell growth. Granulin family members are important in normal development, wound healing, and tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some knock-out alleles display enhanced macrophage functions. Mice homozygous for another knock-out allele display reproductive and behavioral abnormalities. Mice homozygous for a third null allele display premature death and increased cellular aging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,595,471 D474G probably benign Het
1190007I07Rik G T 10: 82,620,216 T37K possibly damaging Het
2610507B11Rik C T 11: 78,284,156 R1706C probably damaging Het
Acd A C 8: 105,700,944 S25R probably damaging Het
Acly A T 11: 100,519,743 H136Q probably damaging Het
Adrm1 C T 2: 180,172,039 T2M probably benign Het
Ankrd12 A T 17: 66,024,214 L246M probably damaging Het
Cacnb3 T C 15: 98,642,050 L258P probably damaging Het
Ccdc129 A G 6: 55,872,594 H37R probably benign Het
Cd36 C T 5: 17,820,495 V76M probably damaging Het
Cep120 A G 18: 53,738,561 F80L possibly damaging Het
Clcn1 A T 6: 42,290,585 probably null Het
Col17a1 T C 19: 47,651,801 T1042A probably benign Het
Comp A T 8: 70,380,260 N623Y probably damaging Het
Ctnnal1 A G 4: 56,813,272 L653P probably benign Het
Cx3cl1 G T 8: 94,779,815 R149S probably benign Het
Dbndd2 T A 2: 164,488,602 N58K probably damaging Het
Dclk1 A G 3: 55,502,419 I595V probably damaging Het
Dhx15 T C 5: 52,184,544 D144G probably benign Het
Dlat T C 9: 50,658,707 E120G probably damaging Het
Fam171a1 T A 2: 3,220,315 Y273N probably damaging Het
Fndc3b A T 3: 27,457,027 V778D probably benign Het
Grxcr1 T C 5: 68,110,414 F169L possibly damaging Het
Hcn2 A G 10: 79,724,785 I317V probably benign Het
Heca T C 10: 17,915,676 N211D probably benign Het
Htr1f T C 16: 64,926,051 T293A possibly damaging Het
Ifitm10 T A 7: 142,356,012 I116F probably benign Het
Ivl A T 3: 92,572,679 D26E probably benign Het
Kcnma1 T A 14: 23,386,350 E761V probably benign Het
Ltbp1 G T 17: 75,348,758 V923F probably benign Het
Mfsd4b2 A T 10: 39,923,809 F32L probably benign Het
Micu2 T C 14: 57,923,963 R301G possibly damaging Het
Miip C T 4: 147,863,046 C219Y probably damaging Het
Mn1 T A 5: 111,419,019 L285* probably null Het
Mthfd1l T A 10: 4,048,250 N664K possibly damaging Het
Mttp A T 3: 138,104,676 H659Q probably benign Het
Myadml2 G A 11: 120,647,989 P7S probably benign Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Nlrp4c C T 7: 6,072,645 T645I probably damaging Het
Notch1 C T 2: 26,469,924 V1260I probably damaging Het
Numa1 T C 7: 102,000,941 L1293P probably damaging Het
Olfr403 A T 11: 74,195,589 I29F probably benign Het
Olfr684 A G 7: 105,157,568 L38P probably benign Het
Pcdh12 G T 18: 38,282,138 H645N probably benign Het
Pdcd1 A T 1: 94,041,227 L122H probably damaging Het
Pknox2 G A 9: 36,910,591 P246L probably damaging Het
Polr2a A T 11: 69,735,555 S1590T possibly damaging Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
Proser1 A G 3: 53,477,701 T335A probably benign Het
Ptprc A G 1: 138,083,597 I598T probably damaging Het
Rasal3 T C 17: 32,396,854 T337A probably benign Het
Rasgrp3 A T 17: 75,512,060 T415S probably benign Het
Rbm7 T A 9: 48,489,973 R152* probably null Het
Sf3b2 C T 19: 5,286,229 R513H probably damaging Het
Slc22a30 A G 19: 8,386,671 S214P probably benign Het
Spam1 A G 6: 24,796,985 T312A probably benign Het
Ssh2 A G 11: 77,455,193 T1335A possibly damaging Het
Tef T A 15: 81,814,968 L59Q probably damaging Het
Tmem131l A C 3: 83,928,702 V700G probably damaging Het
Twsg1 A G 17: 65,926,407 S183P probably damaging Het
Unc13c T C 9: 73,932,961 T203A probably benign Het
Vmn2r75 G T 7: 86,165,202 P361Q possibly damaging Het
Xirp2 A T 2: 67,516,634 N3073I probably damaging Het
Zfp114 A G 7: 24,180,645 N140D probably benign Het
Other mutations in Grn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02422:Grn APN 11 102436258 splice site probably benign
IGL02456:Grn APN 11 102436104 missense probably benign 0.01
PIT4434001:Grn UTSW 11 102435940 missense possibly damaging 0.88
R0395:Grn UTSW 11 102436223 missense probably benign 0.03
R0784:Grn UTSW 11 102434502 missense possibly damaging 0.74
R1037:Grn UTSW 11 102433070 missense possibly damaging 0.94
R1753:Grn UTSW 11 102433267 missense probably damaging 1.00
R1905:Grn UTSW 11 102436450 missense probably damaging 1.00
R3110:Grn UTSW 11 102433243 missense probably benign 0.07
R3111:Grn UTSW 11 102433243 missense probably benign 0.07
R3112:Grn UTSW 11 102433243 missense probably benign 0.07
R3974:Grn UTSW 11 102436339 missense probably damaging 1.00
R4908:Grn UTSW 11 102436518 unclassified probably benign
R4989:Grn UTSW 11 102430554 unclassified probably benign
R5012:Grn UTSW 11 102430554 unclassified probably benign
R5013:Grn UTSW 11 102430554 unclassified probably benign
R5108:Grn UTSW 11 102434402 missense probably benign 0.10
R5133:Grn UTSW 11 102430554 unclassified probably benign
R5134:Grn UTSW 11 102430554 unclassified probably benign
R5162:Grn UTSW 11 102430554 unclassified probably benign
R5182:Grn UTSW 11 102430554 unclassified probably benign
R5183:Grn UTSW 11 102430554 unclassified probably benign
R5308:Grn UTSW 11 102436192 missense possibly damaging 0.96
R5350:Grn UTSW 11 102436244 missense possibly damaging 0.50
R5786:Grn UTSW 11 102434043 nonsense probably null
R6383:Grn UTSW 11 102436795 unclassified probably benign
R7679:Grn UTSW 11 102433069 missense probably benign 0.01
R7741:Grn UTSW 11 102435734 missense probably damaging 1.00
R8312:Grn UTSW 11 102436247 missense probably damaging 0.98
R8682:Grn UTSW 11 102434820 missense probably benign 0.04
R8864:Grn UTSW 11 102436385 missense unknown
Predicted Primers PCR Primer
(F):5'- CTAAGGTGACAGTGCCATTGG -3'
(R):5'- GTTAAACCACTCCAGCATGGC -3'

Sequencing Primer
(F):5'- GCCATTGGCTTGGGGAG -3'
(R):5'- ACTCCAGCATGGCCTCTC -3'
Posted On2021-03-08