Incidental Mutation 'R8677:Nlgn3'
ID661485
Institutional Source Beutler Lab
Gene Symbol Nlgn3
Ensembl Gene ENSMUSG00000031302
Gene Nameneuroligin 3
SynonymsNL3, A230085M13Rik, HNL3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8677 (G1)
Quality Score221.999
Status Not validated
ChromosomeX
Chromosomal Location101299168-101325963 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101308784 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 179 (V179A)
Ref Sequence ENSEMBL: ENSMUSP00000066304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065858] [ENSMUST00000118111] [ENSMUST00000130555] [ENSMUST00000151528]
Predicted Effect probably damaging
Transcript: ENSMUST00000065858
AA Change: V179A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066304
Gene: ENSMUSG00000031302
AA Change: V179A

DomainStartEndE-ValueType
Pfam:COesterase 16 601 2.3e-194 PFAM
Pfam:Abhydrolase_3 180 342 1.7e-7 PFAM
transmembrane domain 685 707 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118111
AA Change: V65A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113863
Gene: ENSMUSG00000031302
AA Change: V65A

DomainStartEndE-ValueType
Pfam:COesterase 3 487 3.6e-161 PFAM
Pfam:Abhydrolase_3 66 232 2.4e-7 PFAM
transmembrane domain 571 593 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130555
AA Change: V159A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122213
Gene: ENSMUSG00000031302
AA Change: V159A

DomainStartEndE-ValueType
Pfam:COesterase 16 510 4.6e-179 PFAM
Pfam:Abhydrolase_3 160 323 1.5e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151528
AA Change: V199A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123283
Gene: ENSMUSG00000031302
AA Change: V199A

DomainStartEndE-ValueType
Pfam:COesterase 16 621 3.4e-207 PFAM
Pfam:Abhydrolase_3 200 363 1.2e-6 PFAM
transmembrane domain 705 727 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of neuronal cell surface proteins. Members of this family may act as splice site-specific ligands for beta-neurexins and may be involved in the formation and remodeling of central nervous system synapses. Mutations in this gene may be associated with autism and Asperger syndrome. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice show impaired context and cued conditioning, hyperactivity, altered social behavior, less vocalization, smaller brains, and impaired olfaction. Males carrying a knock-in allele show impaired social interaction, and enhanced spatial learning and inhibitory synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,595,471 D474G probably benign Het
1190007I07Rik G T 10: 82,620,216 T37K possibly damaging Het
2610507B11Rik C T 11: 78,284,156 R1706C probably damaging Het
Acd A C 8: 105,700,944 S25R probably damaging Het
Acly A T 11: 100,519,743 H136Q probably damaging Het
Adrm1 C T 2: 180,172,039 T2M probably benign Het
Ankrd12 A T 17: 66,024,214 L246M probably damaging Het
Cacnb3 T C 15: 98,642,050 L258P probably damaging Het
Ccdc129 A G 6: 55,872,594 H37R probably benign Het
Cd36 C T 5: 17,820,495 V76M probably damaging Het
Cep120 A G 18: 53,738,561 F80L possibly damaging Het
Clcn1 A T 6: 42,290,585 probably null Het
Col17a1 T C 19: 47,651,801 T1042A probably benign Het
Comp A T 8: 70,380,260 N623Y probably damaging Het
Ctnnal1 A G 4: 56,813,272 L653P probably benign Het
Cx3cl1 G T 8: 94,779,815 R149S probably benign Het
Dbndd2 T A 2: 164,488,602 N58K probably damaging Het
Dclk1 A G 3: 55,502,419 I595V probably damaging Het
Dhx15 T C 5: 52,184,544 D144G probably benign Het
Dlat T C 9: 50,658,707 E120G probably damaging Het
Fam171a1 T A 2: 3,220,315 Y273N probably damaging Het
Fndc3b A T 3: 27,457,027 V778D probably benign Het
Grn T C 11: 102,433,567 S129P possibly damaging Het
Grxcr1 T C 5: 68,110,414 F169L possibly damaging Het
Hcn2 A G 10: 79,724,785 I317V probably benign Het
Heca T C 10: 17,915,676 N211D probably benign Het
Htr1f T C 16: 64,926,051 T293A possibly damaging Het
Ifitm10 T A 7: 142,356,012 I116F probably benign Het
Ivl A T 3: 92,572,679 D26E probably benign Het
Kcnma1 T A 14: 23,386,350 E761V probably benign Het
Ltbp1 G T 17: 75,348,758 V923F probably benign Het
Mfsd4b2 A T 10: 39,923,809 F32L probably benign Het
Micu2 T C 14: 57,923,963 R301G possibly damaging Het
Miip C T 4: 147,863,046 C219Y probably damaging Het
Mn1 T A 5: 111,419,019 L285* probably null Het
Mthfd1l T A 10: 4,048,250 N664K possibly damaging Het
Mttp A T 3: 138,104,676 H659Q probably benign Het
Myadml2 G A 11: 120,647,989 P7S probably benign Het
Nlrp4c C T 7: 6,072,645 T645I probably damaging Het
Notch1 C T 2: 26,469,924 V1260I probably damaging Het
Numa1 T C 7: 102,000,941 L1293P probably damaging Het
Olfr403 A T 11: 74,195,589 I29F probably benign Het
Olfr684 A G 7: 105,157,568 L38P probably benign Het
Pcdh12 G T 18: 38,282,138 H645N probably benign Het
Pdcd1 A T 1: 94,041,227 L122H probably damaging Het
Pknox2 G A 9: 36,910,591 P246L probably damaging Het
Polr2a A T 11: 69,735,555 S1590T possibly damaging Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
Proser1 A G 3: 53,477,701 T335A probably benign Het
Ptprc A G 1: 138,083,597 I598T probably damaging Het
Rasal3 T C 17: 32,396,854 T337A probably benign Het
Rasgrp3 A T 17: 75,512,060 T415S probably benign Het
Rbm7 T A 9: 48,489,973 R152* probably null Het
Sf3b2 C T 19: 5,286,229 R513H probably damaging Het
Slc22a30 A G 19: 8,386,671 S214P probably benign Het
Spam1 A G 6: 24,796,985 T312A probably benign Het
Ssh2 A G 11: 77,455,193 T1335A possibly damaging Het
Tef T A 15: 81,814,968 L59Q probably damaging Het
Tmem131l A C 3: 83,928,702 V700G probably damaging Het
Twsg1 A G 17: 65,926,407 S183P probably damaging Het
Unc13c T C 9: 73,932,961 T203A probably benign Het
Vmn2r75 G T 7: 86,165,202 P361Q possibly damaging Het
Xirp2 A T 2: 67,516,634 N3073I probably damaging Het
Zfp114 A G 7: 24,180,645 N140D probably benign Het
Other mutations in Nlgn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Nlgn3 APN X 101320092 missense probably benign 0.28
IGL01327:Nlgn3 APN X 101318622 missense probably benign 0.08
IGL01414:Nlgn3 APN X 101302260 missense probably benign 0.00
R1296:Nlgn3 UTSW X 101308916 splice site probably benign
R1794:Nlgn3 UTSW X 101320033 missense probably benign 0.30
R5144:Nlgn3 UTSW X 101318285 missense probably benign 0.21
R5145:Nlgn3 UTSW X 101318285 missense probably benign 0.21
R5146:Nlgn3 UTSW X 101318285 missense probably benign 0.21
R8678:Nlgn3 UTSW X 101308784 missense probably damaging 1.00
R8684:Nlgn3 UTSW X 101319819 nonsense probably null
R8696:Nlgn3 UTSW X 101308784 missense probably damaging 1.00
Z1176:Nlgn3 UTSW X 101317982 missense probably benign 0.30
Z1176:Nlgn3 UTSW X 101319877 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGCCAGTACTTCAACTCC -3'
(R):5'- TAACACCAGCGAGAGATCTAGGAC -3'

Sequencing Primer
(F):5'- AGTACTTCAACTCCGGGCCTAG -3'
(R):5'- AGGACTACCTAAATTGACTTCCCTGG -3'
Posted On2021-03-08