Incidental Mutation 'R8678:Fcnb'
ID 661490
Institutional Source Beutler Lab
Gene Symbol Fcnb
Ensembl Gene ENSMUSG00000026835
Gene Name ficolin B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8678 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 28076378-28084885 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 28078349 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 199 (F199L)
Ref Sequence ENSEMBL: ENSMUSP00000028179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028179] [ENSMUST00000117486] [ENSMUST00000135472]
AlphaFold O70497
Predicted Effect possibly damaging
Transcript: ENSMUST00000028179
AA Change: F199L

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028179
Gene: ENSMUSG00000026835
AA Change: F199L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Collagen 39 99 1.1e-11 PFAM
FBG 101 314 1.78e-115 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000117486
AA Change: F199L

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112625
Gene: ENSMUSG00000026835
AA Change: F199L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Collagen 39 99 6.7e-12 PFAM
FBG 101 250 1.33e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135472
SMART Domains Protein: ENSMUSP00000119098
Gene: ENSMUSG00000026835

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Collagen 38 81 5.3e-10 PFAM
internal_repeat_1 86 107 1.19e-5 PROSPERO
Meta Mutation Damage Score 0.5749 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The ficolin family of proteins are characterized by the presence of a leader peptide, a short N-terminal segment, followed by a collagen-like region, and a C-terminal fibrinogen-like domain. The collagen-like and the fibrinogen-like domains are also found separately in other proteins such as complement protein C1q, C-type lectins known as collectins, and tenascins. However, all these proteins recognize different targets, and are functionally distinct. Ficolin 1 encoded by FCN1 is predominantly expressed in the peripheral blood leukocytes, and has been postulated to function as a plasma protein with elastin-binding activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to Streptococcus pneumoniae infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 C T 16: 20,365,935 M991I probably benign Het
Acacb T A 5: 114,201,971 Y814* probably null Het
Alg2 A G 4: 47,474,108 F60S probably damaging Het
Arc A G 15: 74,671,690 L228P probably damaging Het
Bnip1 T A 17: 26,789,949 probably benign Het
Cacng4 A G 11: 107,735,099 L222P probably damaging Het
Calb2 A T 8: 110,147,643 V182E possibly damaging Het
Cfap44 A T 16: 44,475,273 I1645F probably damaging Het
Col6a5 T C 9: 105,934,352 D656G unknown Het
Csmd3 A G 15: 47,636,453 S2096P Het
Cyp2c70 A T 19: 40,167,572 I178N probably damaging Het
Dmxl1 C T 18: 49,871,692 Q936* probably null Het
Dnaaf3 A T 7: 4,530,815 F94Y probably damaging Het
Doxl2 C T 6: 48,976,224 T361I possibly damaging Het
Eid2b C T 7: 28,278,055 T92I possibly damaging Het
Ercc8 T C 13: 108,169,493 probably null Het
Fank1 G A 7: 133,862,228 probably null Het
Fbxw19 C A 9: 109,483,308 E324* probably null Het
Galnt16 A G 12: 80,584,048 D300G probably damaging Het
Gli1 T C 10: 127,337,391 S133G probably null Het
Gm13084 C A 4: 143,812,006 A132S probably benign Het
Ighv5-8 TATACAT TAT 12: 113,654,963 probably benign Het
Irak4 A G 15: 94,566,785 D412G probably benign Het
Klhl20 A T 1: 161,109,427 I126N probably damaging Het
Lama1 A G 17: 67,817,103 E2841G Het
Lmtk3 T A 7: 45,786,551 C85* probably null Het
Madd T C 2: 91,176,265 Y328C probably damaging Het
Map1a G T 2: 121,307,256 R2851L probably damaging Het
Mctp2 T C 7: 72,103,207 D766G probably damaging Het
Mei4 T A 9: 81,927,585 F240L probably damaging Het
Mgat3 A T 15: 80,212,271 Y433F possibly damaging Het
Muc20 T A 16: 32,797,419 probably benign Het
Nat8f1 A G 6: 85,910,756 V74A probably benign Het
Nfe2l3 A G 6: 51,458,173 D571G possibly damaging Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Nphs1 T C 7: 30,463,859 L480S probably damaging Het
Nr1d1 G C 11: 98,769,247 R484G probably damaging Het
Olfr1057 C T 2: 86,374,725 R229H probably benign Het
Olfr1228 T A 2: 89,249,007 Y217F probably damaging Het
Olfr706 A G 7: 106,886,073 V248A probably damaging Het
Parp10 C A 15: 76,233,399 C929F probably damaging Het
Pcdhb21 A G 18: 37,514,886 E356G probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Plch1 T A 3: 63,716,047 R600* probably null Het
Ppp1r13l C A 7: 19,375,772 T706K probably benign Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
Ppp1r16b G A 2: 158,757,022 R334Q probably damaging Het
Ppp1r7 A G 1: 93,352,642 Q188R probably benign Het
Prkdc G T 16: 15,708,932 probably null Het
Prss33 T C 17: 23,834,749 D118G probably benign Het
Rab3gap2 T G 1: 185,251,084 I473M probably damaging Het
Rbm44 A G 1: 91,152,381 E97G probably damaging Het
Ros1 A G 10: 52,087,902 M1775T probably benign Het
Ryr1 T A 7: 29,077,064 M2216L probably damaging Het
Scn7a A G 2: 66,743,697 probably benign Het
Slc31a2 G A 4: 62,292,659 V12M probably benign Het
Slc35b1 T C 11: 95,387,820 Y177H probably damaging Het
Slfn9 T A 11: 82,981,544 M789L probably benign Het
Srf A G 17: 46,550,899 probably null Het
Tank A G 2: 61,626,943 E81G probably damaging Het
Tia1 T A 6: 86,425,703 M241K probably benign Het
Tiam1 G T 16: 89,884,821 S423* probably null Het
Tubg1 T G 11: 101,124,438 S237A probably benign Het
Ubash3b G A 9: 41,031,489 P358S probably benign Het
Vmn2r3 T C 3: 64,259,475 E745G possibly damaging Het
Vmn2r4 T A 3: 64,406,970 I197F probably benign Het
Vps37d C A 5: 135,076,532 R79L probably damaging Het
Wdr7 T A 18: 63,777,697 L720Q probably damaging Het
Xkr5 T C 8: 18,934,032 N498S probably benign Het
Zc2hc1c A T 12: 85,290,310 E247V probably benign Het
Other mutations in Fcnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Fcnb APN 2 28076801 missense probably benign 0.04
IGL02130:Fcnb APN 2 28084789 critical splice donor site probably null
IGL02348:Fcnb APN 2 28084830 missense possibly damaging 0.88
IGL02504:Fcnb APN 2 28076594 missense probably damaging 1.00
IGL03118:Fcnb APN 2 28076618 missense probably benign 0.06
IGL03179:Fcnb APN 2 28076634 missense possibly damaging 0.93
R0217:Fcnb UTSW 2 28079677 missense probably benign 0.02
R0899:Fcnb UTSW 2 28076779 missense probably damaging 1.00
R3901:Fcnb UTSW 2 28079196 missense probably damaging 1.00
R5845:Fcnb UTSW 2 28079621 critical splice donor site probably null
R5911:Fcnb UTSW 2 28076689 missense probably damaging 1.00
R6065:Fcnb UTSW 2 28079910 missense probably damaging 1.00
R6188:Fcnb UTSW 2 28079190 missense possibly damaging 0.94
R6488:Fcnb UTSW 2 28078289 missense probably damaging 1.00
R8058:Fcnb UTSW 2 28079695 missense probably damaging 1.00
R8194:Fcnb UTSW 2 28078318 missense possibly damaging 0.65
R8195:Fcnb UTSW 2 28078318 missense possibly damaging 0.65
R8196:Fcnb UTSW 2 28078318 missense possibly damaging 0.65
R8198:Fcnb UTSW 2 28078318 missense possibly damaging 0.65
R8199:Fcnb UTSW 2 28078318 missense possibly damaging 0.65
R9224:Fcnb UTSW 2 28079148 missense probably damaging 1.00
R9261:Fcnb UTSW 2 28079624 missense probably damaging 0.99
X0024:Fcnb UTSW 2 28076691 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCGCTGATGTCAACCCTAG -3'
(R):5'- AAGATGTTGGTACCTACCCCG -3'

Sequencing Primer
(F):5'- TGATGTCAACCCTAGGCTCAAGG -3'
(R):5'- CCCGGTGAATTCCAAGTTCAG -3'
Posted On 2021-03-08