Mutagenetix > Incidental Mutation

Incidental Mutation 'R8678:Acacb'

661504

Institutional Source

Beutler Lab

Gene Symbol

Acacb

Ensembl Gene

ENSMUSG00000042010

Gene Name

acetyl-Coenzyme A carboxylase beta

Synonyms

Acc2, Accb

MMRRC Submission

068533-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8678 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

114146535-114250761 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 114201971 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 814 (Y814*)

Ref Sequence

ENSEMBL: ENSMUSP00000031583 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]

AlphaFold

E9Q4Z2

Predicted Effect

probably null
Transcript: ENSMUST00000031583
AA Change: Y814*

SMART Domains

Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: Y814*

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	2.1e-32	PFAM
Pfam:CPSase_L_D2	405	606	3.3e-52	PFAM
Pfam:ATP-grasp_4	413	576	2.1e-9	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	1.9e-17	PFAM
Pfam:ACC_central	952	1678	2.2e-290	PFAM
Pfam:Carboxyl_trans	1770	2324	2.3e-181	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000102582
AA Change: Y814*

SMART Domains

Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: Y814*

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	8.2e-29	PFAM
Pfam:CPSase_L_D2	405	606	3.8e-52	PFAM
Pfam:ATP-grasp_4	409	576	1.4e-12	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	9.1e-17	PFAM
Pfam:ACC_central	952	1678	2.3e-250	PFAM
Pfam:Carboxyl_trans	1770	2324	4.8e-172	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 96.7%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	C	T	16: 20,365,935	M991I	probably benign	Het
Alg2	A	G	4: 47,474,108	F60S	probably damaging	Het
Arc	A	G	15: 74,671,690	L228P	probably damaging	Het
Bnip1	T	A	17: 26,789,949		probably benign	Het
Cacng4	A	G	11: 107,735,099	L222P	probably damaging	Het
Calb2	A	T	8: 110,147,643	V182E	possibly damaging	Het
Cfap44	A	T	16: 44,475,273	I1645F	probably damaging	Het
Col6a5	T	C	9: 105,934,352	D656G	unknown	Het
Csmd3	A	G	15: 47,636,453	S2096P		Het
Cyp2c70	A	T	19: 40,167,572	I178N	probably damaging	Het
Dmxl1	C	T	18: 49,871,692	Q936*	probably null	Het
Dnaaf3	A	T	7: 4,530,815	F94Y	probably damaging	Het
Doxl2	C	T	6: 48,976,224	T361I	possibly damaging	Het
Eid2b	C	T	7: 28,278,055	T92I	possibly damaging	Het
Ercc8	T	C	13: 108,169,493		probably null	Het
Fank1	G	A	7: 133,862,228		probably null	Het
Fbxw19	C	A	9: 109,483,308	E324*	probably null	Het
Fcnb	A	G	2: 28,078,349	F199L	possibly damaging	Het
Galnt16	A	G	12: 80,584,048	D300G	probably damaging	Het
Gli1	T	C	10: 127,337,391	S133G	probably null	Het
Gm13084	C	A	4: 143,812,006	A132S	probably benign	Het
Ighv5-8	TATACAT	TAT	12: 113,654,963		probably benign	Het
Irak4	A	G	15: 94,566,785	D412G	probably benign	Het
Klhl20	A	T	1: 161,109,427	I126N	probably damaging	Het
Lama1	A	G	17: 67,817,103	E2841G		Het
Lmtk3	T	A	7: 45,786,551	C85*	probably null	Het
Madd	T	C	2: 91,176,265	Y328C	probably damaging	Het
Map1a	G	T	2: 121,307,256	R2851L	probably damaging	Het
Mctp2	T	C	7: 72,103,207	D766G	probably damaging	Het
Mei4	T	A	9: 81,927,585	F240L	probably damaging	Het
Mgat3	A	T	15: 80,212,271	Y433F	possibly damaging	Het
Muc20	T	A	16: 32,797,419		probably benign	Het
Nat8f1	A	G	6: 85,910,756	V74A	probably benign	Het
Nfe2l3	A	G	6: 51,458,173	D571G	possibly damaging	Het
Nlgn3	T	C	X: 101,308,784	V179A	probably damaging	Het
Nphs1	T	C	7: 30,463,859	L480S	probably damaging	Het
Nr1d1	G	C	11: 98,769,247	R484G	probably damaging	Het
Olfr1057	C	T	2: 86,374,725	R229H	probably benign	Het
Olfr1228	T	A	2: 89,249,007	Y217F	probably damaging	Het
Olfr706	A	G	7: 106,886,073	V248A	probably damaging	Het
Parp10	C	A	15: 76,233,399	C929F	probably damaging	Het
Pcdhb21	A	G	18: 37,514,886	E356G	probably damaging	Het
Peg10	CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC	CATC	6: 4,756,431		probably benign	Het
Plch1	T	A	3: 63,716,047	R600*	probably null	Het
Ppp1r13l	C	A	7: 19,375,772	T706K	probably benign	Het
Ppp1r16b	G	A	2: 158,751,178	D226N	probably damaging	Het
Ppp1r16b	G	A	2: 158,757,022	R334Q	probably damaging	Het
Ppp1r7	A	G	1: 93,352,642	Q188R	probably benign	Het
Prkdc	G	T	16: 15,708,932		probably null	Het
Prss33	T	C	17: 23,834,749	D118G	probably benign	Het
Rab3gap2	T	G	1: 185,251,084	I473M	probably damaging	Het
Rbm44	A	G	1: 91,152,381	E97G	probably damaging	Het
Ros1	A	G	10: 52,087,902	M1775T	probably benign	Het
Ryr1	T	A	7: 29,077,064	M2216L	probably damaging	Het
Scn7a	A	G	2: 66,743,697		probably benign	Het
Slc31a2	G	A	4: 62,292,659	V12M	probably benign	Het
Slc35b1	T	C	11: 95,387,820	Y177H	probably damaging	Het
Slfn9	T	A	11: 82,981,544	M789L	probably benign	Het
Srf	A	G	17: 46,550,899		probably null	Het
Tank	A	G	2: 61,626,943	E81G	probably damaging	Het
Tia1	T	A	6: 86,425,703	M241K	probably benign	Het
Tiam1	G	T	16: 89,884,821	S423*	probably null	Het
Tubg1	T	G	11: 101,124,438	S237A	probably benign	Het
Ubash3b	G	A	9: 41,031,489	P358S	probably benign	Het
Vmn2r3	T	C	3: 64,259,475	E745G	possibly damaging	Het
Vmn2r4	T	A	3: 64,406,970	I197F	probably benign	Het
Vps37d	C	A	5: 135,076,532	R79L	probably damaging	Het
Wdr7	T	A	18: 63,777,697	L720Q	probably damaging	Het
Xkr5	T	C	8: 18,934,032	N498S	probably benign	Het
Zc2hc1c	A	T	12: 85,290,310	E247V	probably benign	Het

Other mutations in Acacb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Acacb	APN	5	114200289	missense	probably damaging	1.00
IGL01291:Acacb	APN	5	114225870	missense	probably benign	0.03
IGL01301:Acacb	APN	5	114246498	missense	probably benign
IGL01633:Acacb	APN	5	114218858	splice site	probably benign
IGL01736:Acacb	APN	5	114188442	missense	possibly damaging	0.96
IGL01782:Acacb	APN	5	114200520	missense	probably damaging	1.00
IGL01924:Acacb	APN	5	114223986	splice site	probably benign
IGL01933:Acacb	APN	5	114184190	splice site	probably benign
IGL02028:Acacb	APN	5	114166015	missense	probably damaging	1.00
IGL02045:Acacb	APN	5	114240660	missense	possibly damaging	0.95
IGL02346:Acacb	APN	5	114238699	missense	probably damaging	1.00
IGL02421:Acacb	APN	5	114223878	missense	probably benign	0.00
IGL02445:Acacb	APN	5	114245137	missense	probably damaging	1.00
IGL02491:Acacb	APN	5	114192105	missense	probably damaging	1.00
IGL02598:Acacb	APN	5	114246037	missense	probably damaging	1.00
IGL02700:Acacb	APN	5	114218881	missense	probably damaging	1.00
IGL02730:Acacb	APN	5	114166149	splice site	probably benign
IGL03110:Acacb	APN	5	114195234	missense	probably damaging	0.96
IGL03125:Acacb	APN	5	114204805	missense	possibly damaging	0.49
IGL03263:Acacb	APN	5	114213693	missense	probably damaging	1.00
IGL03324:Acacb	APN	5	114225854	nonsense	probably null
acetone	UTSW	5	114226857	nonsense	probably null
anabolism	UTSW	5	114245220	missense	possibly damaging	0.63
ANU05:Acacb	UTSW	5	114225870	missense	probably benign	0.03
ANU18:Acacb	UTSW	5	114246498	missense	probably benign
BB001:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
BB011:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
I0000:Acacb	UTSW	5	114238655	missense	probably damaging	0.99
R0001:Acacb	UTSW	5	114204833	splice site	probably benign
R0219:Acacb	UTSW	5	114232944	missense	possibly damaging	0.79
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0278:Acacb	UTSW	5	114233259	nonsense	probably null
R0607:Acacb	UTSW	5	114200301	missense	probably damaging	1.00
R0964:Acacb	UTSW	5	114229752	missense	possibly damaging	0.64
R1116:Acacb	UTSW	5	114210956	missense	probably damaging	1.00
R1196:Acacb	UTSW	5	114245092	missense	probably benign	0.00
R1204:Acacb	UTSW	5	114190153	missense	probably damaging	1.00
R1387:Acacb	UTSW	5	114200512	missense	probably benign
R1415:Acacb	UTSW	5	114165921	missense	probably benign
R1475:Acacb	UTSW	5	114195252	missense	possibly damaging	0.87
R1497:Acacb	UTSW	5	114196807	missense	probably damaging	1.00
R1520:Acacb	UTSW	5	114201940	missense	possibly damaging	0.67
R1591:Acacb	UTSW	5	114203423	missense	possibly damaging	0.87
R1644:Acacb	UTSW	5	114195285	missense	probably damaging	1.00
R1732:Acacb	UTSW	5	114190087	missense	possibly damaging	0.63
R1783:Acacb	UTSW	5	114209767	frame shift	probably null
R1784:Acacb	UTSW	5	114209767	frame shift	probably null
R1834:Acacb	UTSW	5	114235475	missense	probably damaging	1.00
R1858:Acacb	UTSW	5	114196709	missense	probably benign	0.13
R1886:Acacb	UTSW	5	114218959	missense	probably damaging	1.00
R1901:Acacb	UTSW	5	114165734	nonsense	probably null
R1902:Acacb	UTSW	5	114165734	nonsense	probably null
R1903:Acacb	UTSW	5	114165734	nonsense	probably null
R1924:Acacb	UTSW	5	114230720	missense	possibly damaging	0.67
R1934:Acacb	UTSW	5	114198282	missense	probably benign	0.27
R2051:Acacb	UTSW	5	114245890	missense	probably damaging	1.00
R2132:Acacb	UTSW	5	114209767	frame shift	probably null
R2133:Acacb	UTSW	5	114209767	frame shift	probably null
R2260:Acacb	UTSW	5	114216917	missense	probably damaging	0.99
R2967:Acacb	UTSW	5	114166070	missense	possibly damaging	0.81
R3421:Acacb	UTSW	5	114212636	splice site	probably null
R3729:Acacb	UTSW	5	114207348	missense	probably damaging	0.99
R4206:Acacb	UTSW	5	114213651	missense	probably benign
R4245:Acacb	UTSW	5	114230784	missense	probably damaging	0.97
R4386:Acacb	UTSW	5	114241921	critical splice acceptor site	probably null
R4439:Acacb	UTSW	5	114246496	missense	possibly damaging	0.50
R4577:Acacb	UTSW	5	114226831	missense	probably damaging	1.00
R4658:Acacb	UTSW	5	114200564	missense	probably damaging	0.96
R4688:Acacb	UTSW	5	114204763	missense	probably benign	0.01
R4720:Acacb	UTSW	5	114229914	missense	possibly damaging	0.73
R4898:Acacb	UTSW	5	114232938	missense	probably benign	0.04
R5044:Acacb	UTSW	5	114166027	missense	probably benign	0.03
R5070:Acacb	UTSW	5	114246028	missense	possibly damaging	0.46
R5294:Acacb	UTSW	5	114241952	missense	probably damaging	1.00
R5350:Acacb	UTSW	5	114244551	missense	probably damaging	1.00
R5401:Acacb	UTSW	5	114209853	missense	possibly damaging	0.80
R5531:Acacb	UTSW	5	114204706	missense	possibly damaging	0.92
R5542:Acacb	UTSW	5	114195737	missense	probably damaging	1.00
R5751:Acacb	UTSW	5	114230832	missense	possibly damaging	0.79
R5821:Acacb	UTSW	5	114184106	missense	possibly damaging	0.69
R5893:Acacb	UTSW	5	114229851	missense	probably benign	0.01
R5911:Acacb	UTSW	5	114232890	missense	probably damaging	0.97
R5944:Acacb	UTSW	5	114245980	missense	probably damaging	1.00
R5973:Acacb	UTSW	5	114226867	missense	probably damaging	1.00
R6027:Acacb	UTSW	5	114165600	missense	probably benign	0.43
R6103:Acacb	UTSW	5	114245881	missense	probably damaging	1.00
R6139:Acacb	UTSW	5	114212652	missense	probably damaging	1.00
R6292:Acacb	UTSW	5	114200251	missense	probably damaging	1.00
R6368:Acacb	UTSW	5	114216823	missense	probably damaging	0.98
R6429:Acacb	UTSW	5	114228591	missense	probably damaging	1.00
R6942:Acacb	UTSW	5	114191963	critical splice donor site	probably null
R7138:Acacb	UTSW	5	114207326	missense	probably benign	0.12
R7241:Acacb	UTSW	5	114245100	missense	possibly damaging	0.94
R7254:Acacb	UTSW	5	114209751	critical splice acceptor site	probably null
R7396:Acacb	UTSW	5	114213661	missense	possibly damaging	0.87
R7439:Acacb	UTSW	5	114195642	missense	possibly damaging	0.84
R7484:Acacb	UTSW	5	114218862	missense	probably damaging	1.00
R7585:Acacb	UTSW	5	114246012	missense	probably damaging	0.99
R7712:Acacb	UTSW	5	114165738	missense	probably benign	0.13
R7868:Acacb	UTSW	5	114248227	missense	probably benign	0.22
R7873:Acacb	UTSW	5	114223278	missense	possibly damaging	0.88
R7924:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
R7940:Acacb	UTSW	5	114166047	missense	possibly damaging	0.77
R7951:Acacb	UTSW	5	114188340	missense	probably damaging	1.00
R7960:Acacb	UTSW	5	114230861	missense	probably benign	0.00
R7972:Acacb	UTSW	5	114226857	nonsense	probably null
R8007:Acacb	UTSW	5	114218874	missense	probably damaging	0.97
R8022:Acacb	UTSW	5	114223854	missense	probably benign
R8030:Acacb	UTSW	5	114233167	missense	probably damaging	1.00
R8241:Acacb	UTSW	5	114195236	missense	possibly damaging	0.49
R8264:Acacb	UTSW	5	114207366	missense	probably benign	0.00
R8292:Acacb	UTSW	5	114200494	critical splice acceptor site	probably null
R8693:Acacb	UTSW	5	114226783	missense	probably damaging	0.99
R8697:Acacb	UTSW	5	114213380	missense	probably damaging	0.96
R8772:Acacb	UTSW	5	114184118	missense	possibly damaging	0.73
R8918:Acacb	UTSW	5	114195254	missense	probably damaging	1.00
R9008:Acacb	UTSW	5	114248754	splice site	silent
R9044:Acacb	UTSW	5	114235517	missense	probably benign	0.00
R9165:Acacb	UTSW	5	114216683	missense	probably benign	0.01
R9231:Acacb	UTSW	5	114211092	missense	probably benign	0.01
R9440:Acacb	UTSW	5	114246024	missense	possibly damaging	0.56
R9444:Acacb	UTSW	5	114245959	missense	probably damaging	0.99
R9562:Acacb	UTSW	5	114233336	missense	probably damaging	0.99
R9794:Acacb	UTSW	5	114249517	missense	probably benign	0.00
V1662:Acacb	UTSW	5	114238708	missense	probably damaging	1.00
Z1176:Acacb	UTSW	5	114248948	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GGCTTTGTACACAGGAGCAC -3'
(R):5'- AAAGACAGCATTCTTTGGGTTCC -3'

Sequencing Primer
(F):5'- AGCACCTGTTCTGCCATGGAG -3'
(R):5'- AGCATTCTTTGGGTTCCACTCAAG -3'

Posted On

2021-03-08