Incidental Mutation 'R0238:Hspa9'
Institutional Source Beutler Lab
Gene Symbol Hspa9
Ensembl Gene ENSMUSG00000024359
Gene Nameheat shock protein 9
SynonymsC3H-specific antigen, mthsp70, GRP75, PBP74, CSA, Hsc74, mot-2, Hsp74a, Hspa9a, Hsp74, mortalin
MMRRC Submission 038476-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R0238 (G1)
Quality Score221
Status Not validated
Chromosomal Location34937414-34954357 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 34946646 bp
Amino Acid Change Tyrosine to Stop codon at position 243 (Y243*)
Ref Sequence ENSEMBL: ENSMUSP00000025217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025217]
Predicted Effect probably null
Transcript: ENSMUST00000025217
AA Change: Y243*
SMART Domains Protein: ENSMUSP00000025217
Gene: ENSMUSG00000024359
AA Change: Y243*

low complexity region 3 26 N/A INTRINSIC
Pfam:HSP70 55 653 2.7e-270 PFAM
Pfam:FGGY_C 283 429 3e-8 PFAM
low complexity region 657 679 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173806
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 92.6%
  • 20x: 76.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heat shock protein 70 gene family. The encoded protein is primarily localized to the mitochondria but is also found in the endoplasmic reticulum, plasma membrane and cytoplasmic vesicles. This protein is a heat-shock cognate protein. This protein plays a role in cell proliferation, stress response and maintenance of the mitochondria. A pseudogene of this gene is found on chromosome 2.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality while heterozygotes display decreased pre-B cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aar2 T G 2: 156,550,973 V94G probably benign Het
Acp5 A T 9: 22,129,922 S70T possibly damaging Het
Adcy1 C G 11: 7,139,162 N525K possibly damaging Het
AI464131 A T 4: 41,498,912 N239K probably benign Het
Aknad1 A G 3: 108,781,239 M628V probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Cacna1d A G 14: 30,123,496 V572A probably benign Het
Ccdc158 A C 5: 92,662,118 M177R probably benign Het
Ccdc191 A T 16: 43,947,496 R678* probably null Het
Cdkn2d C A 9: 21,290,992 probably benign Het
Cdx2 G T 5: 147,303,287 T193K probably damaging Het
Cfap44 T A 16: 44,422,318 M695K probably benign Het
Cfap70 A C 14: 20,448,605 S5A probably benign Het
Chd9 T C 8: 90,932,828 S139P probably damaging Het
Chmp7 A G 14: 69,720,997 V241A probably damaging Het
Cnga1 A G 5: 72,605,031 I380T probably damaging Het
Cts6 T A 13: 61,201,819 E53D probably damaging Het
Dclk3 A T 9: 111,482,628 N646I probably damaging Het
Dnhd1 A G 7: 105,721,531 S4673G probably benign Het
Dock4 G T 12: 40,737,540 S818I probably damaging Het
Dysf C T 6: 84,064,479 Q156* probably null Het
Fam163b T C 2: 27,112,634 N117S probably damaging Het
Fam89a A G 8: 124,741,232 Y114H probably damaging Het
Flcn T C 11: 59,801,076 N249S probably benign Het
Gm20422 T C 8: 69,766,715 Y53C probably damaging Het
Gnai1 A G 5: 18,273,550 S206P probably damaging Het
Hal T C 10: 93,503,482 S478P possibly damaging Het
Haus3 G A 5: 34,166,256 P337S possibly damaging Het
Hectd1 T A 12: 51,769,318 M1324L possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Htr3a T C 9: 48,906,386 T96A probably benign Het
Ift140 C A 17: 25,045,523 C557* probably null Het
Jph3 A G 8: 121,753,720 Q379R possibly damaging Het
Kcnb1 A G 2: 167,104,969 V653A probably benign Het
Kif14 A G 1: 136,527,393 E1551G probably damaging Het
Krt17 G A 11: 100,260,878 R30* probably null Het
Lamb3 A T 1: 193,321,053 D100V probably damaging Het
Map2 A G 1: 66,416,106 D1385G probably damaging Het
Map3k21 A G 8: 125,944,970 D999G possibly damaging Het
Marf1 T C 16: 14,151,283 I109V probably benign Het
Mcam T G 9: 44,140,205 probably null Het
Med18 T C 4: 132,460,026 H99R probably damaging Het
Mettl25 C T 10: 105,826,525 V195I probably damaging Het
Myh8 A G 11: 67,301,692 T1466A probably benign Het
Myo1e A T 9: 70,342,126 I503F possibly damaging Het
Myo3b T A 2: 70,105,425 C61S probably benign Het
Nf1 A T 11: 79,418,574 K438M possibly damaging Het
Nlrp9c A G 7: 26,378,012 S727P possibly damaging Het
Nmbr C T 10: 14,770,395 Q338* probably null Het
Nt5e A G 9: 88,367,332 S440G possibly damaging Het
Nubp2 T C 17: 24,884,471 E144G probably damaging Het
Olfr1126 T C 2: 87,458,037 F291L probably benign Het
Olfr593 G A 7: 103,212,726 V289M possibly damaging Het
Olfr694 A G 7: 106,689,255 Y159H probably benign Het
Otogl T A 10: 107,806,696 N1291I probably damaging Het
Pa2g4 T C 10: 128,563,642 K51R probably benign Het
Pcdhb12 A G 18: 37,436,727 I309V probably benign Het
Pck1 T G 2: 173,157,068 I373S possibly damaging Het
Pga5 A G 19: 10,669,453 Y305H probably damaging Het
Plxnd1 G T 6: 115,968,793 D906E probably benign Het
Ppfia4 T C 1: 134,329,189 E98G possibly damaging Het
Rab39 G A 9: 53,706,030 T29I probably damaging Het
Raet1e C A 10: 22,180,862 H112Q possibly damaging Het
Rars2 T C 4: 34,645,838 Y252H probably damaging Het
Rars2 A C 4: 34,656,030 Q421P probably benign Het
Rasa2 A T 9: 96,568,407 D479E probably damaging Het
Rbl2 A T 8: 91,106,507 T689S probably damaging Het
Rims4 C T 2: 163,864,025 V230M probably benign Het
Skp2 A C 15: 9,127,884 probably null Het
Slc35f4 A T 14: 49,304,256 I347N possibly damaging Het
Slc4a2 A T 5: 24,436,274 probably null Het
Slc52a3 T C 2: 152,008,156 *461Q probably null Het
Slc6a1 G A 6: 114,302,800 V142I probably benign Het
Susd5 A G 9: 114,096,909 *620W probably null Het
Timm21 T C 18: 84,947,666 N239S probably damaging Het
Tmem63c T C 12: 87,075,639 W404R probably damaging Het
Tnrc6b A G 15: 80,887,864 D1118G probably damaging Het
Traf2 G C 2: 25,537,126 A71G possibly damaging Het
Trim54 A G 5: 31,134,119 M195V probably benign Het
Trip11 C T 12: 101,884,728 E741K probably damaging Het
Trp73 AGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTG 4: 154,062,524 probably benign Het
Trpm5 G T 7: 143,082,958 T414N probably damaging Het
Vps51 G T 19: 6,071,437 S185* probably null Het
Zfp329 G T 7: 12,810,829 T256K probably damaging Het
Zfp729b A G 13: 67,591,903 Y748H probably damaging Het
Zfp777 T C 6: 48,024,969 E773G probably damaging Het
Other mutations in Hspa9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Hspa9 APN 18 34938580 splice site probably benign
IGL01939:Hspa9 APN 18 34938708 missense possibly damaging 0.89
IGL02008:Hspa9 APN 18 34947975 nonsense probably null
IGL02604:Hspa9 APN 18 34954213 missense unknown
Chiri-san UTSW 18 34939423 missense probably damaging 1.00
R0238:Hspa9 UTSW 18 34946646 nonsense probably null
R0278:Hspa9 UTSW 18 34940910 missense possibly damaging 0.50
R0613:Hspa9 UTSW 18 34947980 missense probably damaging 1.00
R1414:Hspa9 UTSW 18 34938591 missense probably damaging 1.00
R1454:Hspa9 UTSW 18 34938606 missense probably damaging 1.00
R2013:Hspa9 UTSW 18 34946648 missense probably damaging 1.00
R2014:Hspa9 UTSW 18 34946648 missense probably damaging 1.00
R2015:Hspa9 UTSW 18 34946648 missense probably damaging 1.00
R2936:Hspa9 UTSW 18 34948014 missense probably damaging 1.00
R4261:Hspa9 UTSW 18 34939423 missense probably damaging 1.00
R4622:Hspa9 UTSW 18 34949037 missense possibly damaging 0.48
R4819:Hspa9 UTSW 18 34939388 missense probably damaging 0.98
R5056:Hspa9 UTSW 18 34938681 missense probably damaging 1.00
R5223:Hspa9 UTSW 18 34952671 splice site probably null
R5666:Hspa9 UTSW 18 34954247 missense probably null
R5820:Hspa9 UTSW 18 34943174 missense possibly damaging 0.82
R5944:Hspa9 UTSW 18 34949023 missense possibly damaging 0.94
R6460:Hspa9 UTSW 18 34952712 missense probably benign
R7404:Hspa9 UTSW 18 34943276 missense possibly damaging 0.76
R7412:Hspa9 UTSW 18 34949029 missense probably damaging 1.00
R7637:Hspa9 UTSW 18 34938687 missense not run
R8524:Hspa9 UTSW 18 34954244 missense unknown
Z1177:Hspa9 UTSW 18 34943145 missense possibly damaging 0.96
Predicted Primers
Posted On2013-08-19