Incidental Mutation 'R8678:Nphs1'
ID 661515
Institutional Source Beutler Lab
Gene Symbol Nphs1
Ensembl Gene ENSMUSG00000006649
Gene Name nephrosis 1, nephrin
Synonyms nephrin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8678 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 30458315-30487223 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30463859 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 480 (L480S)
Ref Sequence ENSEMBL: ENSMUSP00000006825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000126297]
AlphaFold Q9QZS7
Predicted Effect probably damaging
Transcript: ENSMUST00000006825
AA Change: L480S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649
AA Change: L480S

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 52 146 1.38e-6 SMART
Pfam:C2-set_2 152 242 4.1e-20 PFAM
IG 264 351 9.86e-3 SMART
IG_like 360 452 2.73e1 SMART
IG 464 556 2.99e-2 SMART
IG_like 572 644 8.9e-1 SMART
IG 667 751 1.32e-3 SMART
IG 760 849 7.3e-6 SMART
IGc2 868 941 5.4e-9 SMART
FN3 955 1036 1.01e-11 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126297
AA Change: L466S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649
AA Change: L466S

DomainStartEndE-ValueType
IG 38 132 1.38e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe proteinuria associated with kidney defects and die soon after birth. Heterozygotes exhibit fusion of one-third of glomerular foot processes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 C T 16: 20,365,935 M991I probably benign Het
Acacb T A 5: 114,201,971 Y814* probably null Het
Alg2 A G 4: 47,474,108 F60S probably damaging Het
Arc A G 15: 74,671,690 L228P probably damaging Het
Bnip1 T A 17: 26,789,949 probably benign Het
Cacng4 A G 11: 107,735,099 L222P probably damaging Het
Calb2 A T 8: 110,147,643 V182E possibly damaging Het
Cfap44 A T 16: 44,475,273 I1645F probably damaging Het
Col6a5 T C 9: 105,934,352 D656G unknown Het
Csmd3 A G 15: 47,636,453 S2096P Het
Cyp2c70 A T 19: 40,167,572 I178N probably damaging Het
Dmxl1 C T 18: 49,871,692 Q936* probably null Het
Dnaaf3 A T 7: 4,530,815 F94Y probably damaging Het
Doxl2 C T 6: 48,976,224 T361I possibly damaging Het
Eid2b C T 7: 28,278,055 T92I possibly damaging Het
Ercc8 T C 13: 108,169,493 probably null Het
Fank1 G A 7: 133,862,228 probably null Het
Fbxw19 C A 9: 109,483,308 E324* probably null Het
Fcnb A G 2: 28,078,349 F199L possibly damaging Het
Galnt16 A G 12: 80,584,048 D300G probably damaging Het
Gli1 T C 10: 127,337,391 S133G probably null Het
Gm13084 C A 4: 143,812,006 A132S probably benign Het
Ighv5-8 TATACAT TAT 12: 113,654,963 probably benign Het
Irak4 A G 15: 94,566,785 D412G probably benign Het
Klhl20 A T 1: 161,109,427 I126N probably damaging Het
Lama1 A G 17: 67,817,103 E2841G Het
Lmtk3 T A 7: 45,786,551 C85* probably null Het
Madd T C 2: 91,176,265 Y328C probably damaging Het
Map1a G T 2: 121,307,256 R2851L probably damaging Het
Mctp2 T C 7: 72,103,207 D766G probably damaging Het
Mei4 T A 9: 81,927,585 F240L probably damaging Het
Mgat3 A T 15: 80,212,271 Y433F possibly damaging Het
Muc20 T A 16: 32,797,419 probably benign Het
Nat8f1 A G 6: 85,910,756 V74A probably benign Het
Nfe2l3 A G 6: 51,458,173 D571G possibly damaging Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Nr1d1 G C 11: 98,769,247 R484G probably damaging Het
Olfr1057 C T 2: 86,374,725 R229H probably benign Het
Olfr1228 T A 2: 89,249,007 Y217F probably damaging Het
Olfr706 A G 7: 106,886,073 V248A probably damaging Het
Parp10 C A 15: 76,233,399 C929F probably damaging Het
Pcdhb21 A G 18: 37,514,886 E356G probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Plch1 T A 3: 63,716,047 R600* probably null Het
Ppp1r13l C A 7: 19,375,772 T706K probably benign Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
Ppp1r16b G A 2: 158,757,022 R334Q probably damaging Het
Ppp1r7 A G 1: 93,352,642 Q188R probably benign Het
Prkdc G T 16: 15,708,932 probably null Het
Prss33 T C 17: 23,834,749 D118G probably benign Het
Rab3gap2 T G 1: 185,251,084 I473M probably damaging Het
Rbm44 A G 1: 91,152,381 E97G probably damaging Het
Ros1 A G 10: 52,087,902 M1775T probably benign Het
Ryr1 T A 7: 29,077,064 M2216L probably damaging Het
Scn7a A G 2: 66,743,697 probably benign Het
Slc31a2 G A 4: 62,292,659 V12M probably benign Het
Slc35b1 T C 11: 95,387,820 Y177H probably damaging Het
Slfn9 T A 11: 82,981,544 M789L probably benign Het
Srf A G 17: 46,550,899 probably null Het
Tank A G 2: 61,626,943 E81G probably damaging Het
Tia1 T A 6: 86,425,703 M241K probably benign Het
Tiam1 G T 16: 89,884,821 S423* probably null Het
Tubg1 T G 11: 101,124,438 S237A probably benign Het
Ubash3b G A 9: 41,031,489 P358S probably benign Het
Vmn2r3 T C 3: 64,259,475 E745G possibly damaging Het
Vmn2r4 T A 3: 64,406,970 I197F probably benign Het
Vps37d C A 5: 135,076,532 R79L probably damaging Het
Wdr7 T A 18: 63,777,697 L720Q probably damaging Het
Xkr5 T C 8: 18,934,032 N498S probably benign Het
Zc2hc1c A T 12: 85,290,310 E247V probably benign Het
Other mutations in Nphs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Nphs1 APN 7 30482551 missense possibly damaging 0.77
IGL00927:Nphs1 APN 7 30460739 unclassified probably benign
IGL00976:Nphs1 APN 7 30460685 missense possibly damaging 0.78
IGL01397:Nphs1 APN 7 30486664 missense probably benign 0.01
IGL01465:Nphs1 APN 7 30486714 makesense probably null
IGL01889:Nphs1 APN 7 30460511 missense probably damaging 1.00
IGL02383:Nphs1 APN 7 30481635 splice site probably benign
R0020:Nphs1 UTSW 7 30463208 missense probably benign 0.01
R0485:Nphs1 UTSW 7 30467515 missense probably benign
R1024:Nphs1 UTSW 7 30474277 missense probably damaging 1.00
R1115:Nphs1 UTSW 7 30481378 splice site probably benign
R1144:Nphs1 UTSW 7 30481678 splice site probably benign
R1289:Nphs1 UTSW 7 30471178 missense probably damaging 1.00
R1317:Nphs1 UTSW 7 30481831 splice site probably benign
R1617:Nphs1 UTSW 7 30482531 missense probably benign
R1756:Nphs1 UTSW 7 30461534 missense probably benign 0.00
R1937:Nphs1 UTSW 7 30474373 missense probably damaging 1.00
R2144:Nphs1 UTSW 7 30460970 missense probably benign 0.13
R2256:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2257:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2277:Nphs1 UTSW 7 30467564 nonsense probably null
R3104:Nphs1 UTSW 7 30467540 nonsense probably null
R3106:Nphs1 UTSW 7 30467540 nonsense probably null
R3151:Nphs1 UTSW 7 30460240 missense probably benign
R3765:Nphs1 UTSW 7 30471210 missense probably damaging 0.98
R4078:Nphs1 UTSW 7 30467520 nonsense probably null
R4397:Nphs1 UTSW 7 30481965 splice site probably null
R4635:Nphs1 UTSW 7 30468007 missense probably benign 0.39
R4650:Nphs1 UTSW 7 30482470 missense probably benign 0.21
R4811:Nphs1 UTSW 7 30460429 missense probably damaging 1.00
R4850:Nphs1 UTSW 7 30463232 missense possibly damaging 0.78
R5272:Nphs1 UTSW 7 30481642 missense possibly damaging 0.86
R5327:Nphs1 UTSW 7 30463825 missense probably benign 0.00
R5681:Nphs1 UTSW 7 30486625 missense probably benign 0.00
R5865:Nphs1 UTSW 7 30474385 missense probably damaging 1.00
R5975:Nphs1 UTSW 7 30466115 missense possibly damaging 0.82
R6186:Nphs1 UTSW 7 30465634 missense probably damaging 0.98
R6198:Nphs1 UTSW 7 30467915 missense probably damaging 0.97
R6353:Nphs1 UTSW 7 30474544 missense probably damaging 0.99
R7405:Nphs1 UTSW 7 30462828 missense possibly damaging 0.46
R7647:Nphs1 UTSW 7 30481965 splice site probably null
R7767:Nphs1 UTSW 7 30463308 missense probably damaging 1.00
R8132:Nphs1 UTSW 7 30482053 missense probably benign 0.02
R8485:Nphs1 UTSW 7 30466173 missense probably damaging 0.98
R8890:Nphs1 UTSW 7 30462655 missense probably damaging 1.00
R8946:Nphs1 UTSW 7 30463200 missense probably damaging 1.00
R9133:Nphs1 UTSW 7 30460667 nonsense probably null
R9159:Nphs1 UTSW 7 30465601 missense possibly damaging 0.93
R9347:Nphs1 UTSW 7 30471169 missense probably damaging 1.00
R9547:Nphs1 UTSW 7 30481450 missense probably benign 0.00
R9548:Nphs1 UTSW 7 30481450 missense probably benign 0.00
R9607:Nphs1 UTSW 7 30463587 missense probably damaging 1.00
R9626:Nphs1 UTSW 7 30467566 missense probably benign 0.16
R9720:Nphs1 UTSW 7 30466074 missense possibly damaging 0.83
R9733:Nphs1 UTSW 7 30467530 missense probably damaging 1.00
X0028:Nphs1 UTSW 7 30467504 missense probably null 0.01
Z1177:Nphs1 UTSW 7 30470903 missense probably damaging 1.00
Z1186:Nphs1 UTSW 7 30460350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAACCCAGAGCCCGAAGAG -3'
(R):5'- GGACAGCTCAGTCAGTAGAGTG -3'

Sequencing Primer
(F):5'- AGAGCCCGAAGAGGCCTC -3'
(R):5'- CAGCTCAGTCAGTAGAGTGTGAGTG -3'
Posted On 2021-03-08