Incidental Mutation 'R8678:Nphs1'
ID 661515
Institutional Source Beutler Lab
Gene Symbol Nphs1
Ensembl Gene ENSMUSG00000006649
Gene Name nephrosis 1, nephrin
Synonyms nephrin
MMRRC Submission 068533-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8678 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 30157740-30186648 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30163284 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 480 (L480S)
Ref Sequence ENSEMBL: ENSMUSP00000006825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000126297]
AlphaFold Q9QZS7
Predicted Effect probably damaging
Transcript: ENSMUST00000006825
AA Change: L480S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649
AA Change: L480S

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 52 146 1.38e-6 SMART
Pfam:C2-set_2 152 242 4.1e-20 PFAM
IG 264 351 9.86e-3 SMART
IG_like 360 452 2.73e1 SMART
IG 464 556 2.99e-2 SMART
IG_like 572 644 8.9e-1 SMART
IG 667 751 1.32e-3 SMART
IG 760 849 7.3e-6 SMART
IGc2 868 941 5.4e-9 SMART
FN3 955 1036 1.01e-11 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126297
AA Change: L466S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649
AA Change: L466S

DomainStartEndE-ValueType
IG 38 132 1.38e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe proteinuria associated with kidney defects and die soon after birth. Heterozygotes exhibit fusion of one-third of glomerular foot processes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 C T 16: 20,184,685 (GRCm39) M991I probably benign Het
Acacb T A 5: 114,340,032 (GRCm39) Y814* probably null Het
Alg2 A G 4: 47,474,108 (GRCm39) F60S probably damaging Het
Aoc1l1 C T 6: 48,953,158 (GRCm39) T361I possibly damaging Het
Arc A G 15: 74,543,539 (GRCm39) L228P probably damaging Het
Bnip1 T A 17: 27,008,923 (GRCm39) probably benign Het
Cacng4 A G 11: 107,625,925 (GRCm39) L222P probably damaging Het
Calb2 A T 8: 110,874,275 (GRCm39) V182E possibly damaging Het
Cfap44 A T 16: 44,295,636 (GRCm39) I1645F probably damaging Het
Col6a5 T C 9: 105,811,551 (GRCm39) D656G unknown Het
Csmd3 A G 15: 47,499,849 (GRCm39) S2096P Het
Cyp2c70 A T 19: 40,156,016 (GRCm39) I178N probably damaging Het
Dmxl1 C T 18: 50,004,759 (GRCm39) Q936* probably null Het
Dnaaf3 A T 7: 4,533,814 (GRCm39) F94Y probably damaging Het
Eid2b C T 7: 27,977,480 (GRCm39) T92I possibly damaging Het
Ercc8 T C 13: 108,306,027 (GRCm39) probably null Het
Fank1 G A 7: 133,463,957 (GRCm39) probably null Het
Fbxw19 C A 9: 109,312,376 (GRCm39) E324* probably null Het
Fcnb A G 2: 27,968,361 (GRCm39) F199L possibly damaging Het
Galnt16 A G 12: 80,630,822 (GRCm39) D300G probably damaging Het
Gli1 T C 10: 127,173,260 (GRCm39) S133G probably null Het
Ighv5-8 TATACAT TAT 12: 113,618,583 (GRCm39) probably benign Het
Irak4 A G 15: 94,464,666 (GRCm39) D412G probably benign Het
Klhl20 A T 1: 160,936,997 (GRCm39) I126N probably damaging Het
Lama1 A G 17: 68,124,098 (GRCm39) E2841G Het
Lmtk3 T A 7: 45,435,975 (GRCm39) C85* probably null Het
Madd T C 2: 91,006,610 (GRCm39) Y328C probably damaging Het
Map1a G T 2: 121,137,737 (GRCm39) R2851L probably damaging Het
Mctp2 T C 7: 71,752,955 (GRCm39) D766G probably damaging Het
Mei4 T A 9: 81,809,638 (GRCm39) F240L probably damaging Het
Mgat3 A T 15: 80,096,472 (GRCm39) Y433F possibly damaging Het
Muc20 T A 16: 32,617,789 (GRCm39) probably benign Het
Nat8f1 A G 6: 85,887,738 (GRCm39) V74A probably benign Het
Nfe2l3 A G 6: 51,435,153 (GRCm39) D571G possibly damaging Het
Nlgn3 T C X: 100,352,390 (GRCm39) V179A probably damaging Het
Nr1d1 G C 11: 98,660,073 (GRCm39) R484G probably damaging Het
Or2ag2 A G 7: 106,485,280 (GRCm39) V248A probably damaging Het
Or4c122 T A 2: 89,079,351 (GRCm39) Y217F probably damaging Het
Or8j3b C T 2: 86,205,069 (GRCm39) R229H probably benign Het
Parp10 C A 15: 76,117,599 (GRCm39) C929F probably damaging Het
Pcdhb21 A G 18: 37,647,939 (GRCm39) E356G probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 (GRCm39) probably benign Het
Plch1 T A 3: 63,623,468 (GRCm39) R600* probably null Het
Ppp1r13l C A 7: 19,109,697 (GRCm39) T706K probably benign Het
Ppp1r16b G A 2: 158,593,098 (GRCm39) D226N probably damaging Het
Ppp1r16b G A 2: 158,598,942 (GRCm39) R334Q probably damaging Het
Ppp1r7 A G 1: 93,280,364 (GRCm39) Q188R probably benign Het
Pramel26 C A 4: 143,538,576 (GRCm39) A132S probably benign Het
Prkdc G T 16: 15,526,796 (GRCm39) probably null Het
Prss33 T C 17: 24,053,723 (GRCm39) D118G probably benign Het
Rab3gap2 T G 1: 184,983,281 (GRCm39) I473M probably damaging Het
Rbm44 A G 1: 91,080,103 (GRCm39) E97G probably damaging Het
Ros1 A G 10: 51,963,998 (GRCm39) M1775T probably benign Het
Ryr1 T A 7: 28,776,489 (GRCm39) M2216L probably damaging Het
Scn7a A G 2: 66,574,041 (GRCm39) probably benign Het
Slc31a2 G A 4: 62,210,896 (GRCm39) V12M probably benign Het
Slc35b1 T C 11: 95,278,646 (GRCm39) Y177H probably damaging Het
Slfn9 T A 11: 82,872,370 (GRCm39) M789L probably benign Het
Srf A G 17: 46,861,825 (GRCm39) probably null Het
Tank A G 2: 61,457,287 (GRCm39) E81G probably damaging Het
Tia1 T A 6: 86,402,685 (GRCm39) M241K probably benign Het
Tiam1 G T 16: 89,681,709 (GRCm39) S423* probably null Het
Tubg1 T G 11: 101,015,264 (GRCm39) S237A probably benign Het
Ubash3b G A 9: 40,942,785 (GRCm39) P358S probably benign Het
Vmn2r3 T C 3: 64,166,896 (GRCm39) E745G possibly damaging Het
Vmn2r4 T A 3: 64,314,391 (GRCm39) I197F probably benign Het
Vps37d C A 5: 135,105,386 (GRCm39) R79L probably damaging Het
Wdr7 T A 18: 63,910,768 (GRCm39) L720Q probably damaging Het
Xkr5 T C 8: 18,984,048 (GRCm39) N498S probably benign Het
Zc2hc1c A T 12: 85,337,084 (GRCm39) E247V probably benign Het
Other mutations in Nphs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Nphs1 APN 7 30,181,976 (GRCm39) missense possibly damaging 0.77
IGL00927:Nphs1 APN 7 30,160,164 (GRCm39) unclassified probably benign
IGL00976:Nphs1 APN 7 30,160,110 (GRCm39) missense possibly damaging 0.78
IGL01397:Nphs1 APN 7 30,186,089 (GRCm39) missense probably benign 0.01
IGL01465:Nphs1 APN 7 30,186,139 (GRCm39) makesense probably null
IGL01889:Nphs1 APN 7 30,159,936 (GRCm39) missense probably damaging 1.00
IGL02383:Nphs1 APN 7 30,181,060 (GRCm39) splice site probably benign
R0020:Nphs1 UTSW 7 30,162,633 (GRCm39) missense probably benign 0.01
R0485:Nphs1 UTSW 7 30,166,940 (GRCm39) missense probably benign
R1024:Nphs1 UTSW 7 30,173,702 (GRCm39) missense probably damaging 1.00
R1115:Nphs1 UTSW 7 30,180,803 (GRCm39) splice site probably benign
R1144:Nphs1 UTSW 7 30,181,103 (GRCm39) splice site probably benign
R1289:Nphs1 UTSW 7 30,170,603 (GRCm39) missense probably damaging 1.00
R1317:Nphs1 UTSW 7 30,181,256 (GRCm39) splice site probably benign
R1617:Nphs1 UTSW 7 30,181,956 (GRCm39) missense probably benign
R1756:Nphs1 UTSW 7 30,160,959 (GRCm39) missense probably benign 0.00
R1937:Nphs1 UTSW 7 30,173,798 (GRCm39) missense probably damaging 1.00
R2144:Nphs1 UTSW 7 30,160,395 (GRCm39) missense probably benign 0.13
R2256:Nphs1 UTSW 7 30,167,417 (GRCm39) missense possibly damaging 0.94
R2257:Nphs1 UTSW 7 30,167,417 (GRCm39) missense possibly damaging 0.94
R2277:Nphs1 UTSW 7 30,166,989 (GRCm39) nonsense probably null
R3104:Nphs1 UTSW 7 30,166,965 (GRCm39) nonsense probably null
R3106:Nphs1 UTSW 7 30,166,965 (GRCm39) nonsense probably null
R3151:Nphs1 UTSW 7 30,159,665 (GRCm39) missense probably benign
R3765:Nphs1 UTSW 7 30,170,635 (GRCm39) missense probably damaging 0.98
R4078:Nphs1 UTSW 7 30,166,945 (GRCm39) nonsense probably null
R4397:Nphs1 UTSW 7 30,181,390 (GRCm39) splice site probably null
R4635:Nphs1 UTSW 7 30,167,432 (GRCm39) missense probably benign 0.39
R4650:Nphs1 UTSW 7 30,181,895 (GRCm39) missense probably benign 0.21
R4811:Nphs1 UTSW 7 30,159,854 (GRCm39) missense probably damaging 1.00
R4850:Nphs1 UTSW 7 30,162,657 (GRCm39) missense possibly damaging 0.78
R5272:Nphs1 UTSW 7 30,181,067 (GRCm39) missense possibly damaging 0.86
R5327:Nphs1 UTSW 7 30,163,250 (GRCm39) missense probably benign 0.00
R5681:Nphs1 UTSW 7 30,186,050 (GRCm39) missense probably benign 0.00
R5865:Nphs1 UTSW 7 30,173,810 (GRCm39) missense probably damaging 1.00
R5975:Nphs1 UTSW 7 30,165,540 (GRCm39) missense possibly damaging 0.82
R6186:Nphs1 UTSW 7 30,165,059 (GRCm39) missense probably damaging 0.98
R6198:Nphs1 UTSW 7 30,167,340 (GRCm39) missense probably damaging 0.97
R6353:Nphs1 UTSW 7 30,173,969 (GRCm39) missense probably damaging 0.99
R7405:Nphs1 UTSW 7 30,162,253 (GRCm39) missense possibly damaging 0.46
R7647:Nphs1 UTSW 7 30,181,390 (GRCm39) splice site probably null
R7767:Nphs1 UTSW 7 30,162,733 (GRCm39) missense probably damaging 1.00
R8132:Nphs1 UTSW 7 30,181,478 (GRCm39) missense probably benign 0.02
R8485:Nphs1 UTSW 7 30,165,598 (GRCm39) missense probably damaging 0.98
R8890:Nphs1 UTSW 7 30,162,080 (GRCm39) missense probably damaging 1.00
R8946:Nphs1 UTSW 7 30,162,625 (GRCm39) missense probably damaging 1.00
R9133:Nphs1 UTSW 7 30,160,092 (GRCm39) nonsense probably null
R9159:Nphs1 UTSW 7 30,165,026 (GRCm39) missense possibly damaging 0.93
R9347:Nphs1 UTSW 7 30,170,594 (GRCm39) missense probably damaging 1.00
R9547:Nphs1 UTSW 7 30,180,875 (GRCm39) missense probably benign 0.00
R9548:Nphs1 UTSW 7 30,180,875 (GRCm39) missense probably benign 0.00
R9607:Nphs1 UTSW 7 30,163,012 (GRCm39) missense probably damaging 1.00
R9626:Nphs1 UTSW 7 30,166,991 (GRCm39) missense probably benign 0.16
R9720:Nphs1 UTSW 7 30,165,499 (GRCm39) missense possibly damaging 0.83
R9733:Nphs1 UTSW 7 30,166,955 (GRCm39) missense probably damaging 1.00
X0028:Nphs1 UTSW 7 30,166,929 (GRCm39) missense probably null 0.01
Z1177:Nphs1 UTSW 7 30,170,328 (GRCm39) missense probably damaging 1.00
Z1186:Nphs1 UTSW 7 30,159,775 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAACCCAGAGCCCGAAGAG -3'
(R):5'- GGACAGCTCAGTCAGTAGAGTG -3'

Sequencing Primer
(F):5'- AGAGCCCGAAGAGGCCTC -3'
(R):5'- CAGCTCAGTCAGTAGAGTGTGAGTG -3'
Posted On 2021-03-08